78 results about "Peanut kernel" patented technology

The utility model discloses an automatic filling device for peanut kernels, which belongs to the technical field of eight-treasure porridge processing and is technically characterized by comprising a support frame, a support component is mounted on the support frame, a processing box is mounted at the bottom of the support component, and a plurality of peanut suction components for sucking the peanut kernels are mounted on the processing box; wherein a processing box is installed on the side edge of the supporting frame, an air pump is installed in the processing box, an air inlet hose is installed at the air inlet end of the air pump, and the end, away from the air pump, of the air inlet hose communicates with the multiple peanut suction assemblies. Through ingenious design, the device integrates multiple functions of peanut sucking, peeling, crushing, screening, automatic feeding and the like. Specifically, by means of the suction force generated by the air pump, the peanuts are efficiently sucked in, and peel and scrap separation and collection are achieved through the special assembly, so that food cleanliness is guaranteed, and effective utilization of resources is achieved.

The application discloses a kind of fermented Chinese herbal medicine feed suitable for rice-fish integrated breeding mode and preparation method thereof, and the specific component and weight fraction of feed are as follows: imported fish meal 5 parts, soybean meal 22 parts, chicken meal 8 parts, peanut kernel cake 10 parts, rapeseed meal 10 parts, wheat flour 31.95 parts, soybean protein concentrate 5 parts, soybean oil 4 parts, vitamin C polyphosphate 0.1 part, choline chloride (50%) 0.2 part, premix (compound vitamins and compound minerals) 1 part, calcium dihydrogen phosphate 2 parts, lysine hydrochloride (78%) 0.35 part, methionine (99%) 0.2 part, threonine (98%) 0.2 part, compound probiotics 0.01 part, compound Chinese herbal medicine 0.2-2 parts.The base feed is mixed with strain activation liquid uniformly, then bagged, fermented moisture is regulated to 35%, and placed at room temperature for 5-7 days at 25 DEG C to obtain fermented Chinese herbal medicine feed suitable for rice-fish integrated breeding mode.The application adds compound probiotics and compound Chinese herbal medicine, which has the advantages of promoting fish growth, improving feed utilization, improving muscle quality and the like.

The utility model relates to the technical field of peanut kernels, and discloses a peanut kernel wetting device which comprises a storage box, and a stirring and soaking mechanism is arranged inside and outside the storage box; the stirring and soaking mechanism comprises a baffle, the outer surface of the baffle is connected with the interior of a storage box in a clamped mode, a servo motor is arranged above the storage box, a peanut injection port is fixedly connected to the upper surface of the storage box, a water injection pipe is fixedly connected to the inner wall of the storage box, and a controller body is fixedly connected to the left side face of the storage box. A connecting plate and an ultrasonic sensor are fixedly connected to the inner top wall of the storage box, a protective shell and a soaking box are arranged in the storage box, and the power output end of the servo motor sequentially penetrates through the storage box and the connecting plate and extends into the protective shell. According to the peanut kernel wetting device, through the stirring and soaking mechanism, the soaking moisture of peanut kernels can be controlled, the peanut kernels can be fully stirred, and the problem that some of the peanut kernels are wet and some of the peanut kernels are dry is avoided.

The present application relates to the field of food processing and microbial fermentation technology, in particular to a method for preparing peanut Tianbei by soybean whey combined with lactic acid bacteria fermentation and peanut Tianbei, which comprises the following steps: placing clean and dry peanut kernels in soybean whey for cooking, cooking until the peanut kernels have no hard core, draining and spreading to cool, inoculating the soybean whey peanut kernels with lactobacillus plantarum, then performing constant temperature fermentation, sealing, water bath inactivation, cooling to room temperature to obtain inactivated soybean whey lactic acid bacteria fermented peanut kernels, inoculating rhizopus oryzae, fully mixing, placing in a container with holes, performing constant temperature fermentation under suitable conditions, and then performing ripening treatment to obtain peanut Tianbei. The present application uses soybean whey as a natural nutrient matrix for lactic acid bacteria and rhizopus oryzae fermentation, which not only realizes effective enrichment of resveratrol in peanut Tianbei, but also significantly improves the nutritional quality and optimizes the sensory flavor of peanut Tianbei.

The invention discloses a method for improving the stability of peanut butter, and belongs to the technical field of food processing. The invention provides a solution aiming at the problems that the peanut butter is easy to separate out grease and harden in texture in the storage process. The method comprises the following steps: by taking peanut protein powder as a raw material, preparing peanut protein isolate by an alkali-solution and acid-isolation method; measuring the contents of protein, fat and water in the peanut kernels, selecting baking temperature and time according to the measurement result, baking, removing red skin, and grinding to obtain a peanut butter base material; measuring the wet basis protein content and the moisture content of the peanut butter base material, selecting the addition amount of the peanut protein isolate in a range of 2-3% of the mass of the base material, and adding the peanut protein isolate into the base material to enable the wet basis total protein content of the mixture to reach 30-33%; and finally, stirring and mixing the mixture, and standing to obtain the stabilized peanut butter. The method is mainly used for improving the grease separation problem of the peanut butter and improving the storage stability of the peanut butter.

The invention provides a processing method of peanut butter, and belongs to the technical field of food processing. Peanut kernels are degreased through a hydraulic oil pressing device, the content of triglyceride in the peanut kernels is reduced, and product energy is reduced; in order to make up flavor loss caused by reduction of the grease content, enzyme and protease are adopted to conduct enzymolysis on degreased peanut kernels, the hydrolytic activity of protein and saccharides is improved, the content of free amino acid and reducing sugar is increased, and a flavor precursor is provided for Maillard reaction in the subsequent heat treatment process; the heat treatment can promote the generation of aroma substances and enable the flavor to be more harmonious; in order to ensure the quality of the peanut butter and improve the fluidity of the peanut butter, the crushed peanuts after heat treatment and the light-fat peanut oil are mixed and ground, so that the light-fat peanut oil is uniformly dispersed. Compared with traditional peanut triglyceride, the light-fat peanut oil has a lower metabolic energy value and good interfacial activity, not only can improve the rheological property, lubricity and structural stability of the peanut butter, but also can promote release and retention of flavor active substances.

The utility model discloses a husking device and peanut husking machine, including husking mechanism, first outlet, conveying mechanism, the husking mechanism includes first husking mechanism and second husking mechanism, the first husking mechanism is equipped with first extrusion mechanism, the first extrusion mechanism includes squeeze roll and first radian gate, the second husking mechanism is equipped with second extrusion mechanism, and the first radian gate is equipped with second radian gate. The extrusion roller is provided with an extrusion sheet, the extrusion sheet is provided with a connecting piece, the extrusion sheet is connected with the first connecting plate through the connecting piece, and the first radian grid is provided with a first grid bar; the second shelling mechanism is provided with a second extrusion mechanism, the second extrusion mechanism comprises an extrusion roller and a second radian grid, and the second radian grid is provided with a second grid bar. According to the peanut shelling machine, the detachable rubber sheet is adopted as the extrusion sheet, and the extrusion force can be buffered through the elastic deformation of the rubber sheet, so that the damage condition of peanut kernels in the shelling process is reduced.

The invention belongs to the technical field of food processing, and particularly relates to tea rice soup capable of nourishing the stomach and enhancing immunity and a preparation method of the tea rice soup. Comprising the following raw materials in parts by mass: 100-150 parts of glutinous rice, 5-10 parts of red dates, 3-5 parts of honey, 6-10 parts of red beans, 4-5 parts of beef powder, 2.5-3 parts of peanut kernels, 6-10 parts of fruit and vegetable juice, 3-5 parts of a traditional Chinese medicine extract, 4 parts of peach gum, 0.5 part of tea powder, 0.8-1.2 parts of hericium erinaceus powder, 1 part of sea buckthorn fruit powder and 0.5-1 part of wheat oligopeptide. According to the tea-rice soup capable of nourishing the stomach and enhancing the immunity, the basic raw materials form a protective film, repair is enhanced, nutrient absorption is assisted, and the immune raw materials are stable; the fruit and vegetable juice generates substances easy to absorb energy, mucous membrane repair is promoted, and immunostimulation is enhanced; the traditional Chinese medicine extract inhibits pepsin, promotes mucous membrane synthesis, activates immune cells and reduces inflammatory factors.

The invention discloses a peanut drying device with a peeling function, and relates to the technical field of peanut processing, the peanut drying device comprises a base table, the upper side of the base table is fixedly connected with two supporting frames distributed left and right, and a placement cylinder capable of moving up and down is arranged between the two supporting frames; a ventilation table used for connecting an inner cavity of the placement barrel and an external ventilation pipeline is arranged at the bottom of the outer side of the placement barrel, a shielding ring is fixedly connected to the position, close to one side of the end of the placement barrel, of the inner side of the placement barrel, and the inner side of the placement barrel is movably sleeved with a stirring mechanism; the lower side of the placement cylinder is provided with two discharging ports for discharging peanut kernels and peanut coats respectively, and the upper side of the placement cylinder is provided with a feeding port for feeding materials. According to the peanut drying device with the peeling function, materials are directly fed from the feeding port, then the lifting assembly and the separating assembly are utilized, drying, peeling and separating operations of peanuts are achieved, multiple processing steps are integrated, and the production efficiency is improved.

The invention belongs to the technical field of peanut cultivation and quality regulation and control. The invention provides a regulation and control method for improving the quality of peanut seeds. The regulation and control method comprises the steps of basal application treatment, regulation and control treatment in a flowering needle stage and strengthening treatment in a pod bearing stage. By implementing targeted nutrition regulation measures in different growth stages of peanuts, the synergistic effect of soil environment improvement and foliar nutrition supplement is achieved, so that accumulation of sugar and grease in seed kernels is promoted, fatty acid composition is optimized, the oil content and the protein content of the seed kernels are increased, and the yield of peanuts is increased. And finally, comprehensive improvement of flavor quality, grease quality and nutritional quality of the peanut seed kernels is realized.

The invention discloses a peanut kernel producing area identification method based on a near infrared spectrum. The method comprises the following steps: (1) collecting near infrared diffuse reflection spectrum data of peanut kernel samples from different producing areas by using a portable near infrared spectrometer; (2) carrying out preprocessing on the spectral data by utilizing a multiple scatter correction (MSC) method and a Savitzky-Golay smoothing filter; (3) extracting identification information of the spectral data by using a fuzzy identification analysis method; and (4) classifying by using a K neighbor classifier. According to the method, linear identification information of the near infrared spectrum value domain space and the null space of the peanut kernels can be extracted, the K-nearest neighbor classifier is adopted for classification, and the peanut kernel producing area can be rapidly and accurately identified. The peanut kernel producing area identification method based on the near infrared spectrum can be used for accurately identifying the peanut kernel producing area.

The invention relates to an innovative flavor food, in particular to Hangzhou special seafood spicy peanuts integrating Hangzhou special seafood flavor and spicy elements. High-quality peanut kernels are carefully selected, the mellow spicy flavor of sichuanese peppercorn and the hot peppery taste of dried chilli are combined, seafood seasonings such as dried small shrimps and fermented soya beans are ingeniously added, sodium glutamate is used for improving freshness, edible salt and white granulated sugar are used for seasoning, and the spicy peanut kernels are elaborately fried by adopting a unique process. The product not only retains the crispy taste of peanuts, but also adds well-layered spicy seafood experience, and meets the double pursuits of consumers for health and delicious taste.

The application discloses a kind of based on near infrared mildew sorting and low oxygen temperature control squeezing native peanut oil preparation method, belong to edible oil processing technical field, solve the problem of not completely, oil oxidation and nutrient component loss in the preparation process of traditional peanut oil in mouldy particle screening. Including: near infrared spectroscopy detection is combined with artificial sorting and removes mouldy particle to obtain selected peanut kernel;After gradient temperature baking, use citric acid solution to soak and ultrasonic auxiliary treatment to remove impurities and inhibit enzyme activity;Utilize the roll surface to contain the roll crusher of staggered triangle tooth pattern and break peanut kernel to specific particle size to optimize oil extraction efficiency;Segmented temperature control and pressure control screw press machine presses peanut crude oil under nitrogen protection, centrifugal separation and ceramic membrane filtration purify oil and fat.The method is accurately controlled crushing parameter, pressing temperature and inert gas environment, effectively reduces oxidation side reaction, retains peanut oil natural flavor and nutrient component, suitable for producing high quality, low acid value, high stability native peanut oil.

The application provides an INDEL molecular marker linked with peanut kernel weight QTL qHKWA05 and application thereof. The nucleotide sequence of the molecular marker is ATGCATAATATTCCTCCATCT / A, qHKWA05.INDEL molecular marker is located at 106411957 bp of chromosome 106 of peanut cultivar Arahy05, and genotype identification of the INDEL molecular marker is carried out through a PCR method. The molecular marker qHKWA05.INDEL obtained by the application can effectively identify the kernel weight of peanuts, and is used for genetic improvement of peanut kernel traits, so that the selection accuracy of kernel weight and size of hybrid offspring is effectively improved, breeding cost is reduced, breeding efficiency is improved, and the breeding process of breeding new peanut varieties with high yield and processing speciality is accelerated.

The invention provides a production process of high-oleic-acid peanut oil, which comprises the following steps: S1, selecting high-quality high-oleic-acid peanut kernels as an oil material, and screening to remove impurities; s2, performing low-temperature tempering and low-temperature squeezing on the peanut kernels, and filtering by a centrifugal machine to obtain peanut oil; s3, standing and precipitating the peanut oil; s4, carrying out physical filtration by using a plate-and-frame filter; s5, performing freezing and physical filtration; and S6, obtaining the finished high-oleic-acid peanut oil. According to the method, the loss of nutritional ingredients caused by high temperature is avoided, and meanwhile, the protein denaturation of the byproduct peanut meal is greatly reduced through low-temperature squeezing, so that the peanut meal has higher utilization value. A low-temperature filtering mode is adopted to replace a traditional refining process, and the product does not make contact with substances such as alkali, sodium salt, carclazyte and activated carbon in the whole process. Manpower and material resources are saved, the productivity and benefits are greatly increased, and the product quality is improved.

The invention discloses a method for identifying the specificity of red seed coat peanuts based on high antioxidant active substances, which is used for identifying or identifying peeled peanut materials or other industrial and agricultural peanut materials, and constructs a specific chromatographic analysis path based on newly found specific chemical components in the red seed coat peanuts. And the red seed coat peanut raw material is identified and identified based on the specific characteristic chromatographic peak of the red seed coat peanut material. For common peanut protein powder, peeled peanut powder, peeled peanut seed kernels and other common materials, the method can directly identify whether the agricultural and industrial peanut raw materials are red-seed-coat peanut sources or not without depending on the integrity of seed coats, and an important technical basis is provided for quality control and variety identification of the peanut raw materials.

The utility model discloses an electric peanut husking machine, and particularly relates to the technical field of peanut husking, the electric peanut husking machine comprises a husking cabin, the lower end of the husking cabin is provided with a discharging cabin, the upper side of the inner end face of the discharging cabin is provided with a screening supporting plate, and the upper end of the screening supporting plate is provided with a screening plate; a first limiting block and a second limiting block are correspondingly arranged on the two sides of the lower end of the sieve plate respectively; a concave adaptive groove is formed in one side of the outer end face of the first limiting block, and a concave locking groove is formed in one side of the outer end face of the screen plate. When the peanut screening device is actually used, peanut kernels poor in growth vigor are small in size under the corresponding arrangement state of the first limiting blocks, the concave adaptive grooves and the second limiting blocks, so that the screening plate needs to be replaced, the screening plate is conveniently installed through the first limiting blocks and the second limiting blocks, and therefore the convenience of installing and detaching the screening plate is conveniently improved; and when the sieve holes are blocked, the sieve plate is more convenient to disassemble, so that the blocked sieve holes are cleaned.

The application belongs to the technical field of food processing and relates to a peanut kernel red skin removing system and method. The removing system comprises a crusher, a winnowing pipeline, a blower, a first air guide fan and a dust removal system. The discharge port of the crusher is connected with the import end of the winnowing pipeline. The side wall of the winnowing pipeline is provided with an air inlet and a winnowing outlet arranged in an up-down manner. The air inlet and the winnowing outlet are arranged on the two sides of the winnowing pipeline respectively. The dust removal system is connected with the winnowing outlet through a pipeline. The blower is arranged at the air inlet and used for sending air into the winnowing pipeline. The first air guide fan is connected with the tail end of the dust removal system and used for extracting air flow from the winnowing pipeline. The air inlet of the winnowing pipeline is obliquely provided with an air inlet pipe, and the winnowing outlet is provided with a winnowing outlet pipe. The peanut kernel red skin removing system can separate the red skin scraps generated after the peanut kernel is crushed from the peanut kernel, and the red skin scraps are quickly discharged through the dust removal system after being separated, so that the influence of the red skin on the quality of the oil after being pressed is reduced, and the quality of the oil is ensured.

The utility model relates to edible peanut kernel packing technical field, and disclose a kind of edible peanut kernel even quantity packing device, including packer main part and feeding hopper, the top of packer main part is fixedly connected with feed inlet box, the side of feed inlet box is connected with blow pipe, one end of blow pipe is connected with conveying pipe, one end of conveying pipe is connected with drying assembly, the other side of feed inlet box is fixedly connected with dust extraction assembly, the inner wall of feeding hopper is fixedly connected with pusher assembly, drying assembly includes the heating box being connected at conveying pipe one end, the side of heating box is connected with hair dryer;Dust extraction assembly includes dust cover being fixedly connected on the other side of feed inlet box, the top of dust cover is connected with collecting pipe.The edible peanut kernel even quantity packing device, by the setting of drying assembly and dust extraction assembly, reach effectively remove peanut kernel surface moisture and promote surface cleanliness, further improve storage stability and product quality before packing.

The utility model discloses a peanut quantitative packaging device, belongs to the technical field of peanut packaging, and aims to solve the problem that when peanut kernels are quantitatively weighed and packaged, peanut shells contained in the peanut kernels are broken, so that the packaged peanut kernels are insufficient in weight after being weighed. Comprising a base, a storage barrel arranged at one end of the base, a feeding pipe fixedly communicating with one end of the top of the storage barrel, a sealing door arranged on the peripheral face of the storage barrel and a movable screening mechanism used for filtering peanut kernels, and the movable screening mechanism comprises a shaking assembly and a stirring assembly; according to the peanut kernel packaging device, peanut kernels can be fully separated from broken shells, the broken shells can penetrate through the material storage barrel to fall to the bottom of the inner cavity of the material storage barrel so that the broken shells can be recycled after the sealing door is opened, and therefore the situation that the amount of the peanut kernels is insufficient in the packaging process is avoided; therefore, the accuracy of quantitative peanut kernel packaging operation is improved.

The invention discloses protein fat composite paste and a preparation method thereof, and relates to the technical field of food processing, and the protein fat composite paste is prepared from the following raw materials: shrimp meat, pumpkin, olive oil, pork liver, carrot, ginger juice, water, lemon juice and peanut kernel. The preparation method comprises the following steps: S1, preparing the food materials; S2, blanching and removing fishy smell; S3, cooking; S4, stirring the food materials; according to the protein fat composite paste, nutrition balance is achieved through scientific proportioning of various raw materials, the production cost is reduced by simplifying the technological process, the shelf life is prolonged by combining the freezing preservation technology, home making and industrial production adaptability are achieved, and the requirements of modern consumers for healthy, convenient and high-quality food are comprehensively met.

The invention relates to the field of edible oil processing, in particular to a peanut oil processing method which comprises the following steps: step 1, cleaning peanuts, and airing; step 2, putting the peanuts into a hopper of a drying device; step 3, performing shell separation on the peanuts, and conveying peanut kernels into a filtering barrel of a drying device; and 4, introducing drying hot air into the drying device. And the drying hot air is controlled at 50-60 DEG C. Comprising a rack, a universal joint is fixedly connected to the rack, a center shaft is fixedly connected to the other end of the universal joint, a drying cylinder is fixedly connected to the center shaft, a filtering barrel is rotationally connected to the center shaft, a plurality of friction rods are arranged on the inner wall of the filtering barrel, a peeling frame is fixedly connected to the center shaft, a sliding block is slidably connected into the peeling frame, and a peeling roller is rotationally connected into the sliding block; a second electric push rod is fixedly connected between the sliding block and the peeling frame, and a first rotating motor is arranged between the center shaft and the filtering barrel. The peanut coat is completely removed by using drying equipment.

The invention relates to the technical field of peanut kernel crushing, and discloses a peanut crushing device for chili oil, comprising: a crusher in which an adjustable screen drum mechanism is arranged; the adjustable screen drum mechanism comprises an outer screen drum, an inner screen drum and a material throwing inner measuring assembly, the outer screen drum and the inner screen drum are concentrically nested, meshes of the outer screen drum and the inner screen drum are initially aligned, and the meshes of the inner screen drum are staggered by adjusting axial translation of the inner screen drum, so that the diameter of a material passing mesh is dynamically adjusted; through axial translation of the inner screen drum, the meshes of the outer screen drum and the inner screen drum are staggered, so that the effective diameter of the material passing meshes is dynamically adjusted, the flexible adjustment mode of one machine with multiple screens is adopted, the requirement of chili oil for peanut particle size diversification can be met without replacing the screens, and the production efficiency is improved. And the applicability and the operation convenience of the device are greatly improved.

The invention discloses a compound nut plant beverage and a preparation method thereof. The compound nut plant beverage consists of the following raw materials: 30-50 parts of walnut kernels, 20-40 parts of cashew kernels, 15-30 parts of hazelnut kernels, 10-25 parts of macadamia nuts, 8-20 parts of pistachio nuts, 12-25 parts of almond kernels, 5-15 parts of almonds, 15-30 parts of peanut kernels, 5-15 parts of xylitol, 0.5-1.5 parts of microcrystalline cellulose, 0.2-0.8 part of xanthan gum and the balance of purified water, wherein the total amount is 1000 parts. Various nut kernels are adopted as raw materials and are proportioned correspondingly, so that the prepared beverage is rich in various nutritional ingredients such as protein, unsaturated fatty acid, vitamins and mineral substances, and is good in taste; by adopting a high-pressure jet nano-micro crushing technology, the particle size of particles in a beverage system is miniaturized, and the problems that the composite nut beverage is prone to precipitation and fat layering are effectively solved; the preparation method disclosed by the invention is simple to operate and easy for industrial production, and chemical additives are not added in the production process, so that the requirements of consumers on healthy foods are met.

The invention discloses a molecular marker for identifying or assisting in identifying the size of a peanut seed kernel and application of the molecular marker. The Indel molecular marker is located at the 106411958 nucleotide to the 106411977 nucleotide on the fifth chromosome of a peanut genome, and the sequence of the Indel molecular marker is TGCATAATTCCTCATCT. According to the invention, a site which obviously influences the size of a peanut seed kernel is localized by virtue of a segregation population grouping analysis method, a linked competitive allele specific PCR (KASP) functional molecular marker is developed, a candidate gene Arahy.L1PMVE is determined by combining a haplotype of the candidate gene in a natural population, and the gene is named as Ahsseed. The size of the peanut seed kernel can be regulated and controlled through the Indel. The Indel molecular marker disclosed by the invention can identify the size of the peanut seed kernel, is beneficial to promoting the breeding of a peanut variety with a large seed kernel, and improves the breeding efficiency.

The invention discloses a method for rapidly mining quantitative trait genes of peanuts. The method comprises the following steps: constructing a nested correlation mapping group based on a breeding incomplete group, positioning to a site which obviously influences the size of a peanut seed kernel by combining a segregation group grouping analysis method, developing a linked competitive allele specific PCR (KASP) functional molecular marker, further reducing the interval, and analyzing and screening candidate genes through gene sequence difference and expression mode, so as to obtain the molecular marker. And finally determining the candidate gene Arahy.L1PMVE in combination with the haplotype of the candidate gene in a natural population. The method can be used for rapidly and accurately assisting in selection of breeding target characters of the sizes of the peanut seed kernels.

The invention discloses a far embryo end scraping method and a near infrared data processing method for determining the total phenol content of seeds. The far embryo end scraping method comprises the following steps: screening and sampling samples; removing oil interference components; medium and high polarity components are extracted; and finally, measuring the total phenol content of the seeds. According to the infrared data processing method, unground unhulled peanut seed kernels are directly used as a near infrared spectrum data acquisition background, a special far embryo end scraping method is adopted to measure the content of total phenols in peanuts, and a data process is constructed for optimization; for common peanuts and rare hybrid breeding germplasm resources, phenolic components with the content lower than 1% in hybrid breeding early generation materials have consistent compatibility. The research results of the invention can provide technical support for rapid screening of peanut resources with high total phenol content and efficient cultivation of peanut varieties with high total phenol content.

A vertical umbrella-shaped peanut multifunctional shelling device, comprising a shelling chamber, a vertical rotary umbrella-shaped sieve located in the shelling chamber and a wall breaking frame, the vertical rotary umbrella-shaped sieve is rotatably connected in the shelling chamber through a power main shaft, the wall breaking frame is fixedly connected on the shelling chamber, a gap for crushing peanut shells is arranged between the vertical rotary umbrella-shaped sieve and the wall breaking frame, the peanut fruits entering the shelling chamber fall on the vertical rotary umbrella-shaped sieve and are broken after contacting with the wall breaking frame driven by the vertical rotary umbrella-shaped sieve, and the peanut kernels and the broken peanut shells are discharged from the pores of the vertical rotary umbrella-shaped sieve out of the shelling chamber. The vertical sieve separation mode is adopted, so that the actual shelling area is much larger than the actual working area of the horizontal sieve, the open crushing chamber is used, the shelling is carried out by imitating the hand rubbing mode, the high breakage rate caused by the forced damage due to the high pressure in the chamber is avoided, and the working speed of the motor is reduced to improve the breakage rate of the peanut kernel shelling.

The invention discloses a physical refining and purifying production process of peanut oil, which comprises the following steps: step 1, pretreating peanut raw materials, selecting fresh peanut kernels with moisture content, removing impurities through a roller cleaning machine, and controlling the rotating speed of the roller cleaning machine to be 30-40r / min; mildewed and damaged particles are removed through an infrared color sorter, the resolution ratio of the infrared color sorter is not lower than 0.1 mm, and it is guaranteed that the qualification rate of the raw materials is larger than or equal to 99%; step two, performing low-temperature cold pressing, namely feeding the pretreated peanut kernels into a double-helix cold pressing machine, controlling the temperature of a pressing chamber to be 35-40 DEG C, the rotating speed of a screw rod to be 50-60r / min and the pressure of the pressing chamber to be 20-25MPa, and pressing to obtain crude oil; and step 3, centrifugal separation: carrying out two-stage centrifugal separation on the crude oil so as to gradually remove impurities and phospholipids. The invention relates to the technical field of edible oil processing, and particularly provides a physical refining and purifying production process of peanut oil.

The utility model belongs to the processing technology field of spicy peanut, specifically discloses a spicy peanut seasoning device with a stir -frying mechanism, including jar body and support board, the centre between support board swing joint has jar body, the inside of jar body is provided with inner chamber, the both sides of the rear center of inner chamber swing joint respectively has the stirring shaft, the inside of jar body rear end is provided with the cavity. This spicy peanut seasoning device with stir -frying mechanism has stirring shaft swing joint respectively at the both sides of rear center of inner chamber, and the worm is rotated by starting motor, forces the meshing linkage of two groups of worm gears at the bottom, forces the stirring shaft in the inner chamber of jar body to rotate in situ to turn over peanut kernel to seasoning in front, after ending, the stirring shaft also does not rotate automatically because of inertia, and the corresponding screw rod embedded in the threaded block is rotated, and the rotary handle above is inverted jar body and opens the cover plate and pours material, solve the problem that the stir -frying effect is poor.