108 results about "Peanut kernel" patented technology

The invention relates to the technical field of image recognition, in particular to a peanut legume appearance recognition method and system based on FPGA convolution calculation acceleration, and the method comprises the steps: obtaining a peanut image data set, carrying out the preprocessing of the obtained image data set, taking the preprocessed image data set as the input to construct a peanut legume recognition network, and carrying out the recognition of the peanut legume appearance. The method comprises the following steps: constructing a convolution calculation acceleration circuit, carrying out optimization processing on the constructed convolution calculation acceleration circuit, combining the optimized convolution calculation acceleration circuit with a peanut legume recognition network, carrying out image detection by utilizing the peanut legume recognition network combined with the convolution calculation acceleration circuit, and outputting feature information of peanut legumes. The method can effectively improve the peanut legume distinguishing capability, has the characteristics of high precision, high efficiency, high portability and the like, is better applied to on-site peanut legume appearance recognition, and reduces the cost of treating unqualified peanut kernels.

The invention discloses application of a peanut AhNF-YC9 gene in improving the oil content and salt tolerance of plants, and belongs to the technical field of gene engineering. The nucleotide sequence of the peanut AhNF-YC9 gene is as shown in SEQ ID NO: 1, and the coded amino acid sequence of the peanut AhNF-YC9 gene is as shown in SEQ ID NO: 2. The AhNF-YC9 gene is used for constructing a plant expression vector to transform peanuts, so that the AhNF-YC9 gene is excessively expressed in the peanuts, and the oil content of obtained transgenic peanut seeds can be increased by 4.0% at most compared with that of non-transgenic seeds; after stress treatment with 350mM NaCl, the salt tolerance of the transgenic peanut is obviously higher than that of a non-transgenic plant. Therefore, the peanut AhNF-YC9 gene has an important application prospect in improving the oil content and the salt tolerance of the plant.

The utility model discloses an automatic filling device for peanut kernels, which belongs to the technical field of eight-treasure porridge processing and is technically characterized by comprising a support frame, a support component is mounted on the support frame, a processing box is mounted at the bottom of the support component, and a plurality of peanut suction components for sucking the peanut kernels are mounted on the processing box; wherein a processing box is installed on the side edge of the supporting frame, an air pump is installed in the processing box, an air inlet hose is installed at the air inlet end of the air pump, and the end, away from the air pump, of the air inlet hose communicates with the multiple peanut suction assemblies. Through ingenious design, the device integrates multiple functions of peanut sucking, peeling, crushing, screening, automatic feeding and the like. Specifically, by means of the suction force generated by the air pump, the peanuts are efficiently sucked in, and peel and scrap separation and collection are achieved through the special assembly, so that food cleanliness is guaranteed, and effective utilization of resources is achieved.

The application discloses a kind of fermented Chinese herbal medicine feed suitable for rice-fish integrated breeding mode and preparation method thereof, and the specific component and weight fraction of feed are as follows: imported fish meal 5 parts, soybean meal 22 parts, chicken meal 8 parts, peanut kernel cake 10 parts, rapeseed meal 10 parts, wheat flour 31.95 parts, soybean protein concentrate 5 parts, soybean oil 4 parts, vitamin C polyphosphate 0.1 part, choline chloride (50%) 0.2 part, premix (compound vitamins and compound minerals) 1 part, calcium dihydrogen phosphate 2 parts, lysine hydrochloride (78%) 0.35 part, methionine (99%) 0.2 part, threonine (98%) 0.2 part, compound probiotics 0.01 part, compound Chinese herbal medicine 0.2-2 parts.The base feed is mixed with strain activation liquid uniformly, then bagged, fermented moisture is regulated to 35%, and placed at room temperature for 5-7 days at 25 DEG C to obtain fermented Chinese herbal medicine feed suitable for rice-fish integrated breeding mode.The application adds compound probiotics and compound Chinese herbal medicine, which has the advantages of promoting fish growth, improving feed utilization, improving muscle quality and the like.

The utility model relates to the technical field of peanut kernels, and discloses a peanut kernel wetting device which comprises a storage box, and a stirring and soaking mechanism is arranged inside and outside the storage box; the stirring and soaking mechanism comprises a baffle, the outer surface of the baffle is connected with the interior of a storage box in a clamped mode, a servo motor is arranged above the storage box, a peanut injection port is fixedly connected to the upper surface of the storage box, a water injection pipe is fixedly connected to the inner wall of the storage box, and a controller body is fixedly connected to the left side face of the storage box. A connecting plate and an ultrasonic sensor are fixedly connected to the inner top wall of the storage box, a protective shell and a soaking box are arranged in the storage box, and the power output end of the servo motor sequentially penetrates through the storage box and the connecting plate and extends into the protective shell. According to the peanut kernel wetting device, through the stirring and soaking mechanism, the soaking moisture of peanut kernels can be controlled, the peanut kernels can be fully stirred, and the problem that some of the peanut kernels are wet and some of the peanut kernels are dry is avoided.

The utility model discloses a raw material screening drainage device for peanut oil expression, which comprises a raw material box, a lifting support and a cleaning concave box, the raw material box is arranged on the lifting support, and the lifting support is arranged on the cleaning concave box; the utility model relates to the technical field of peanut oil extraction, and the system can more effectively dissolve and wash off soil, dust and other attachments on the surfaces of peanut kernels through high solubility and permeability of saline water, so that the cleaning efficiency of the peanut kernels is improved; due to the fact that the density of the saline water is higher than that of common water, the buoyancy force borne by the peanuts in the saline water is larger, the peanuts can be better separated from heavy impurities and particles, and the screening effect is improved; the saline water has a certain disinfection effect and can kill or inhibit microorganisms such as bacteria and molds on the surfaces of the peanuts, so that the sanitary quality of the peanuts is improved, and the food safety is ensured.

The present application relates to the field of food processing and microbial fermentation technology, in particular to a method for preparing peanut Tianbei by soybean whey combined with lactic acid bacteria fermentation and peanut Tianbei, which comprises the following steps: placing clean and dry peanut kernels in soybean whey for cooking, cooking until the peanut kernels have no hard core, draining and spreading to cool, inoculating the soybean whey peanut kernels with lactobacillus plantarum, then performing constant temperature fermentation, sealing, water bath inactivation, cooling to room temperature to obtain inactivated soybean whey lactic acid bacteria fermented peanut kernels, inoculating rhizopus oryzae, fully mixing, placing in a container with holes, performing constant temperature fermentation under suitable conditions, and then performing ripening treatment to obtain peanut Tianbei. The present application uses soybean whey as a natural nutrient matrix for lactic acid bacteria and rhizopus oryzae fermentation, which not only realizes effective enrichment of resveratrol in peanut Tianbei, but also significantly improves the nutritional quality and optimizes the sensory flavor of peanut Tianbei.

The invention discloses a method for improving the stability of peanut butter, and belongs to the technical field of food processing. The invention provides a solution aiming at the problems that the peanut butter is easy to separate out grease and harden in texture in the storage process. The method comprises the following steps: by taking peanut protein powder as a raw material, preparing peanut protein isolate by an alkali-solution and acid-isolation method; measuring the contents of protein, fat and water in the peanut kernels, selecting baking temperature and time according to the measurement result, baking, removing red skin, and grinding to obtain a peanut butter base material; measuring the wet basis protein content and the moisture content of the peanut butter base material, selecting the addition amount of the peanut protein isolate in a range of 2-3% of the mass of the base material, and adding the peanut protein isolate into the base material to enable the wet basis total protein content of the mixture to reach 30-33%; and finally, stirring and mixing the mixture, and standing to obtain the stabilized peanut butter. The method is mainly used for improving the grease separation problem of the peanut butter and improving the storage stability of the peanut butter.

The oil drying device of the oil press comprises an oil frying pan body, an upper end cover plate is arranged at an upper end opening of the oil frying pan body, a feeding port is formed in one side of the upper end cover plate, and a water supplementing mechanism used for spraying water into the oil frying pan body is arranged on the other side of the upper end cover plate. The water supplementing mechanism comprises a water supply assembly arranged on the upper end face of the upper end cover plate and a water sprinkling assembly arranged on the lower end face of the upper end cover plate, the water sprinkling assembly comprises a water sprinkling plate, the water supply assembly comprises a water storage tank, and the water storage tank is communicated with a water sprinkling cavity in the water sprinkling plate through a first pump body. The upper end cover plate is arranged at the upper end opening of the oil frying pan body, the water supply assembly is arranged on the upper end face of the upper end cover plate, the water sprinkling assembly is arranged on the lower end face of the upper end cover plate, and the water sprinkling assembly comprises a plurality of water sprinkling plates, so that the wetting uniformity of rapeseeds or peanut kernels can be improved when the rapeseeds or the peanut kernels are wetted, and subsequent frying is facilitated.

The invention provides a processing method of peanut butter, and belongs to the technical field of food processing. Peanut kernels are degreased through a hydraulic oil pressing device, the content of triglyceride in the peanut kernels is reduced, and product energy is reduced; in order to make up flavor loss caused by reduction of the grease content, enzyme and protease are adopted to conduct enzymolysis on degreased peanut kernels, the hydrolytic activity of protein and saccharides is improved, the content of free amino acid and reducing sugar is increased, and a flavor precursor is provided for Maillard reaction in the subsequent heat treatment process; the heat treatment can promote the generation of aroma substances and enable the flavor to be more harmonious; in order to ensure the quality of the peanut butter and improve the fluidity of the peanut butter, the crushed peanuts after heat treatment and the light-fat peanut oil are mixed and ground, so that the light-fat peanut oil is uniformly dispersed. Compared with traditional peanut triglyceride, the light-fat peanut oil has a lower metabolic energy value and good interfacial activity, not only can improve the rheological property, lubricity and structural stability of the peanut butter, but also can promote release and retention of flavor active substances.

The present application relates to the field of edible oils, and specifically discloses a preparation process for high-oleic peanut oil and high-oleic peanut oil. A preparation process for high-oleic peanut oil comprises the following steps: raw material selection: selecting peanut kernels with an oleic acid content of 75% or more; cleaning: removing immature kernels, damaged kernels, moldy kernels, stones, and metals from the peanut kernels; removing red skins: roasting the peanut kernels to a moisture content of 4-5.5%, cooling to room temperature, removing the red skins, and obtaining peanut kernels and peanut red skins; pressing: stir-frying the peanut kernels and pressing them to obtain crude oil and peanut cakes, which are then cooled; pre-coating: mixing oil, diatomaceous earth, and perlite, and then circulating pre-coating on a filter device after mixing; filtering: filtering the crude oil using the pre-coated filter device and nitrogen-filling and filling. The preparation process for high-oleic peanut oil of the present application has the advantages of few filtration passes, less use of filtration raw materials, and good low-temperature resistance and difficulty in stratification of the high-oleic peanut oil produced.

The utility model provides a peanut kernel grading and screening device, and relates to the technical field of peanut kernel grading and screening devices, the peanut kernel grading and screening device comprises a screening machine, one side of the screening machine is fixedly connected with a feeding hopper, when the screening machine is used for screening and processing peanut kernels, the peanut kernels are generally put into the feeding hopper, and the screening machine is used for screening and processing the peanut kernels. Then a motor is started to drive a worm to rotate on a bracket, and two worm wheels can be driven to rotate in opposite directions, so that two round rods and a plurality of blanking plates can be driven to do the same movement, peanut kernels put into the feeding hopper are discharged in a uniform stirring manner, and the peanut kernels are prevented from being blocked at an outlet of the feeding hopper; when peanut kernels fall on the screen, the screening machine is started to drive the screen to vibrate, small peanut kernels fall on the next screen through screen holes in the screen, large peanut kernels can be conveyed to the discharging hopper to be discharged, and screening and processing of the peanut kernels are completed.

The utility model discloses a husking device and peanut husking machine, including husking mechanism, first outlet, conveying mechanism, the husking mechanism includes first husking mechanism and second husking mechanism, the first husking mechanism is equipped with first extrusion mechanism, the first extrusion mechanism includes squeeze roll and first radian gate, the second husking mechanism is equipped with second extrusion mechanism, and the first radian gate is equipped with second radian gate. The extrusion roller is provided with an extrusion sheet, the extrusion sheet is provided with a connecting piece, the extrusion sheet is connected with the first connecting plate through the connecting piece, and the first radian grid is provided with a first grid bar; the second shelling mechanism is provided with a second extrusion mechanism, the second extrusion mechanism comprises an extrusion roller and a second radian grid, and the second radian grid is provided with a second grid bar. According to the peanut shelling machine, the detachable rubber sheet is adopted as the extrusion sheet, and the extrusion force can be buffered through the elastic deformation of the rubber sheet, so that the damage condition of peanut kernels in the shelling process is reduced.

The present invention discloses a tissue regeneration promoting and blood enriching holographic organic food material nutritional diet formula and a production process and application thereof, the tissue regeneration promoting and blood enriching holographic organic food material nutritional diet formula comprises a drink and a food which are matched for eating, and the drink comprises 4 g of dried small shrimps, 4 g of wheat bran, 20 g of soybean meal, 3 g of kelp, 5 g of Chinese chestnut powder, 7 g of buckwheat, 2.5 g of Chinese yam powder, 2.5 g of laver, 2 g of salt and 200 g of water; the food comprises 3 g of Brazil chestnuts, 10 g of walnut kernels, 10 g of sunflower seed kernels, 10 g of peanut kernels, 10 g of pine nuts, 14.5 g of wheat flour, 10 g of sweet potato powder, 10 g of potato powder, 10 g of corn flour, 1 g of pseudo-ginseng, 3 g of astragalus membranaceus, 3 g of angelica sinensis, 2 g of fructus lycii, 1.5 g of bletilla striata and 2 g of salt. According to the present invention, the nutrient ratio matching is reasonable, the food material variety is diversified, the food material ratio is balanced, all essential nutrients and a large amount of active biotin can be provided for the human body, the immunity and the self-healing ability are improved, the hematopoietic function is promoted, the hematopoietic cells are promoted, and the resistance of the human body is improved; the product is convenient to manufacture, free of chemical components and harmful substances and meets the hygienic standard.

The utility model relates to the related technical field of peanut kernel processing, in particular to a peanut kernel grinding device which comprises a processing table, a grinding mechanism is arranged at one end of the processing table, and an adjusting mechanism is arranged at one end of the grinding mechanism. According to the peanut kernel crushing device, through the arrangement of the first air cylinder, the connecting rod, the crushing block, the material storage shell, a material passing hole, a supporting rod, a screening plate, screening holes, a second air cylinder and a connecting column, when peanut kernels are crushed, the peanut kernels are placed in the material storage shell, then the first air cylinder is started, the connecting rod drives the crushing block to descend, and the peanut kernels are crushed; the crushed peanut kernels leave the material storage shell through the material through holes, at the moment, the peanut kernels fall on a screening plate, a second air cylinder is started, a connecting column drives the screening plate to move left and right, the peanut kernels can be screened through screening holes, the peanut kernels which are not crushed thoroughly can be screened out, secondary crushing is conducted, and the crushing effect is very good.

The invention belongs to the technical field of food processing, and particularly relates to tea rice soup capable of nourishing the stomach and enhancing immunity and a preparation method of the tea rice soup. Comprising the following raw materials in parts by mass: 100-150 parts of glutinous rice, 5-10 parts of red dates, 3-5 parts of honey, 6-10 parts of red beans, 4-5 parts of beef powder, 2.5-3 parts of peanut kernels, 6-10 parts of fruit and vegetable juice, 3-5 parts of a traditional Chinese medicine extract, 4 parts of peach gum, 0.5 part of tea powder, 0.8-1.2 parts of hericium erinaceus powder, 1 part of sea buckthorn fruit powder and 0.5-1 part of wheat oligopeptide. According to the tea-rice soup capable of nourishing the stomach and enhancing the immunity, the basic raw materials form a protective film, repair is enhanced, nutrient absorption is assisted, and the immune raw materials are stable; the fruit and vegetable juice generates substances easy to absorb energy, mucous membrane repair is promoted, and immunostimulation is enhanced; the traditional Chinese medicine extract inhibits pepsin, promotes mucous membrane synthesis, activates immune cells and reduces inflammatory factors.

The invention discloses a peanut drying device with a peeling function, and relates to the technical field of peanut processing, the peanut drying device comprises a base table, the upper side of the base table is fixedly connected with two supporting frames distributed left and right, and a placement cylinder capable of moving up and down is arranged between the two supporting frames; a ventilation table used for connecting an inner cavity of the placement barrel and an external ventilation pipeline is arranged at the bottom of the outer side of the placement barrel, a shielding ring is fixedly connected to the position, close to one side of the end of the placement barrel, of the inner side of the placement barrel, and the inner side of the placement barrel is movably sleeved with a stirring mechanism; the lower side of the placement cylinder is provided with two discharging ports for discharging peanut kernels and peanut coats respectively, and the upper side of the placement cylinder is provided with a feeding port for feeding materials. According to the peanut drying device with the peeling function, materials are directly fed from the feeding port, then the lifting assembly and the separating assembly are utilized, drying, peeling and separating operations of peanuts are achieved, multiple processing steps are integrated, and the production efficiency is improved.

The invention belongs to the technical field of peanut cultivation and quality regulation and control. The invention provides a regulation and control method for improving the quality of peanut seeds. The regulation and control method comprises the steps of basal application treatment, regulation and control treatment in a flowering needle stage and strengthening treatment in a pod bearing stage. By implementing targeted nutrition regulation measures in different growth stages of peanuts, the synergistic effect of soil environment improvement and foliar nutrition supplement is achieved, so that accumulation of sugar and grease in seed kernels is promoted, fatty acid composition is optimized, the oil content and the protein content of the seed kernels are increased, and the yield of peanuts is increased. And finally, comprehensive improvement of flavor quality, grease quality and nutritional quality of the peanut seed kernels is realized.

The invention discloses a peanut kernel producing area identification method based on a near infrared spectrum. The method comprises the following steps: (1) collecting near infrared diffuse reflection spectrum data of peanut kernel samples from different producing areas by using a portable near infrared spectrometer; (2) carrying out preprocessing on the spectral data by utilizing a multiple scatter correction (MSC) method and a Savitzky-Golay smoothing filter; (3) extracting identification information of the spectral data by using a fuzzy identification analysis method; and (4) classifying by using a K neighbor classifier. According to the method, linear identification information of the near infrared spectrum value domain space and the null space of the peanut kernels can be extracted, the K-nearest neighbor classifier is adopted for classification, and the peanut kernel producing area can be rapidly and accurately identified. The peanut kernel producing area identification method based on the near infrared spectrum can be used for accurately identifying the peanut kernel producing area.

The invention discloses a degreased peanut meal replacement bar and a preparation method thereof. The degreased peanut meal replacement bar comprises the following raw materials by mass: 28-32 g of degreased peanut kernels, 8-12 g of Chinese yam powder, 8-12 g of degreased peanut powder, 10-13 g of xylitol, 3-5 g of peanut essence, 0.3-0.5 g of baking soda, 5-8 g of pumpkin seeds and 17.5-37.7 g of purified water. The degreased peanut kernels serve as main food materials, rich food materials such as the Chinese yam powder, the degreased peanut powder, the pumpkin seeds, the xylitol, the peanut essence and the baking soda and safety additives are supplemented, the prepared degreased peanut meal replacement bar is rich in nutrition and good in taste, compared with traditional meal replacement bars, the sugar content and the fat content are reduced, addition of preservatives and the like is reduced, and the prepared degreased peanut meal replacement bar is rich in nutrition and good in taste. The fat-reducing food not only can meet the health requirement, but also can be suitable for being eaten by people with the fat-reducing requirement, and provides a healthier choice for consumers.

The invention relates to an innovative flavor food, in particular to Hangzhou special seafood spicy peanuts integrating Hangzhou special seafood flavor and spicy elements. High-quality peanut kernels are carefully selected, the mellow spicy flavor of sichuanese peppercorn and the hot peppery taste of dried chilli are combined, seafood seasonings such as dried small shrimps and fermented soya beans are ingeniously added, sodium glutamate is used for improving freshness, edible salt and white granulated sugar are used for seasoning, and the spicy peanut kernels are elaborately fried by adopting a unique process. The product not only retains the crispy taste of peanuts, but also adds well-layered spicy seafood experience, and meets the double pursuits of consumers for health and delicious taste.

The application discloses a kind of based on near infrared mildew sorting and low oxygen temperature control squeezing native peanut oil preparation method, belong to edible oil processing technical field, solve the problem of not completely, oil oxidation and nutrient component loss in the preparation process of traditional peanut oil in mouldy particle screening. Including: near infrared spectroscopy detection is combined with artificial sorting and removes mouldy particle to obtain selected peanut kernel;After gradient temperature baking, use citric acid solution to soak and ultrasonic auxiliary treatment to remove impurities and inhibit enzyme activity;Utilize the roll surface to contain the roll crusher of staggered triangle tooth pattern and break peanut kernel to specific particle size to optimize oil extraction efficiency;Segmented temperature control and pressure control screw press machine presses peanut crude oil under nitrogen protection, centrifugal separation and ceramic membrane filtration purify oil and fat.The method is accurately controlled crushing parameter, pressing temperature and inert gas environment, effectively reduces oxidation side reaction, retains peanut oil natural flavor and nutrient component, suitable for producing high quality, low acid value, high stability native peanut oil.

The application provides an INDEL molecular marker linked with peanut kernel weight QTL qHKWA05 and application thereof. The nucleotide sequence of the molecular marker is ATGCATAATATTCCTCCATCT / A, qHKWA05.INDEL molecular marker is located at 106411957 bp of chromosome 106 of peanut cultivar Arahy05, and genotype identification of the INDEL molecular marker is carried out through a PCR method. The molecular marker qHKWA05.INDEL obtained by the application can effectively identify the kernel weight of peanuts, and is used for genetic improvement of peanut kernel traits, so that the selection accuracy of kernel weight and size of hybrid offspring is effectively improved, breeding cost is reduced, breeding efficiency is improved, and the breeding process of breeding new peanut varieties with high yield and processing speciality is accelerated.

The invention relates to the technical field of raw material crushing and dust removal, in particular to a raw material crushing and dust removal device for protein powder production, which comprises two symmetrically arranged main body plates, and the upper ends of the two main body plates are provided with a first separation mechanism for removing impurities from peanuts; the first separating mechanism comprises a second fixing body fixedly arranged at the upper end of the main body plate, a second through hole is formed in the upper end of the second fixing body, a first empty groove communicating with the second through hole is formed in the upper end of the second fixing body, and a first sieve plate and a second sieve plate are arranged in the first empty groove of the second fixing body; the side faces of the first screening plate and the second screening plate are rotationally connected with the side face of the second fixing body, and transmission mechanisms are arranged on the side faces of the two main body plates. For some peanut kernels hardened due to oxidative rancidity, the numerical value of the pressure sensor is larger than a normal value when the cutter makes contact with the peanut kernels, at the moment, the pressure sensor controls the alarm lamp to be started, and the damaged peanut kernels are adjusted away.

The invention provides a production process of high-oleic-acid peanut oil, which comprises the following steps: S1, selecting high-quality high-oleic-acid peanut kernels as an oil material, and screening to remove impurities; s2, performing low-temperature tempering and low-temperature squeezing on the peanut kernels, and filtering by a centrifugal machine to obtain peanut oil; s3, standing and precipitating the peanut oil; s4, carrying out physical filtration by using a plate-and-frame filter; s5, performing freezing and physical filtration; and S6, obtaining the finished high-oleic-acid peanut oil. According to the method, the loss of nutritional ingredients caused by high temperature is avoided, and meanwhile, the protein denaturation of the byproduct peanut meal is greatly reduced through low-temperature squeezing, so that the peanut meal has higher utilization value. A low-temperature filtering mode is adopted to replace a traditional refining process, and the product does not make contact with substances such as alkali, sodium salt, carclazyte and activated carbon in the whole process. Manpower and material resources are saved, the productivity and benefits are greatly increased, and the product quality is improved.

The invention discloses a method for identifying the specificity of red seed coat peanuts based on high antioxidant active substances, which is used for identifying or identifying peeled peanut materials or other industrial and agricultural peanut materials, and constructs a specific chromatographic analysis path based on newly found specific chemical components in the red seed coat peanuts. And the red seed coat peanut raw material is identified and identified based on the specific characteristic chromatographic peak of the red seed coat peanut material. For common peanut protein powder, peeled peanut powder, peeled peanut seed kernels and other common materials, the method can directly identify whether the agricultural and industrial peanut raw materials are red-seed-coat peanut sources or not without depending on the integrity of seed coats, and an important technical basis is provided for quality control and variety identification of the peanut raw materials.

The utility model relates to a peanut shell opening machine, which belongs to the field of food processing equipment and comprises a crushing part and a screening part, the crushing part is detachably arranged above the screening part, and the crushing part is composed of a crushing shell, a crushing mechanism fixedly connected in an inner cavity of the crushing shell and a crank penetrating through the side wall of the crushing shell to be in transmission connection with the crushing mechanism. The screening part comprises a screening shell and a first screening plate, an opening is formed in the upper end face of the screening shell, the first screening plate is detachably connected to the inner wall of the screening shell, and a plurality of screening holes for peanut kernels to pass through are evenly distributed in the first screening plate. According to the peanut shell breaking and kernel removing device, the first sieve plate and the second sieve plate are used for screening shells and peels in sequence, the structure is simple, faults are not prone to occurring, crushing of peanut shells can be guaranteed, the crushed shells and peels can be collected, the environment cannot be polluted, and the overall efficiency of shell breaking and kernel removing is improved.

The utility model discloses an electric peanut husking machine, and particularly relates to the technical field of peanut husking, the electric peanut husking machine comprises a husking cabin, the lower end of the husking cabin is provided with a discharging cabin, the upper side of the inner end face of the discharging cabin is provided with a screening supporting plate, and the upper end of the screening supporting plate is provided with a screening plate; a first limiting block and a second limiting block are correspondingly arranged on the two sides of the lower end of the sieve plate respectively; a concave adaptive groove is formed in one side of the outer end face of the first limiting block, and a concave locking groove is formed in one side of the outer end face of the screen plate. When the peanut screening device is actually used, peanut kernels poor in growth vigor are small in size under the corresponding arrangement state of the first limiting blocks, the concave adaptive grooves and the second limiting blocks, so that the screening plate needs to be replaced, the screening plate is conveniently installed through the first limiting blocks and the second limiting blocks, and therefore the convenience of installing and detaching the screening plate is conveniently improved; and when the sieve holes are blocked, the sieve plate is more convenient to disassemble, so that the blocked sieve holes are cleaned.

The application belongs to the technical field of food processing and relates to a peanut kernel red skin removing system and method. The removing system comprises a crusher, a winnowing pipeline, a blower, a first air guide fan and a dust removal system. The discharge port of the crusher is connected with the import end of the winnowing pipeline. The side wall of the winnowing pipeline is provided with an air inlet and a winnowing outlet arranged in an up-down manner. The air inlet and the winnowing outlet are arranged on the two sides of the winnowing pipeline respectively. The dust removal system is connected with the winnowing outlet through a pipeline. The blower is arranged at the air inlet and used for sending air into the winnowing pipeline. The first air guide fan is connected with the tail end of the dust removal system and used for extracting air flow from the winnowing pipeline. The air inlet of the winnowing pipeline is obliquely provided with an air inlet pipe, and the winnowing outlet is provided with a winnowing outlet pipe. The peanut kernel red skin removing system can separate the red skin scraps generated after the peanut kernel is crushed from the peanut kernel, and the red skin scraps are quickly discharged through the dust removal system after being separated, so that the influence of the red skin on the quality of the oil after being pressed is reduced, and the quality of the oil is ensured.

The utility model relates to edible peanut kernel packing technical field, and disclose a kind of edible peanut kernel even quantity packing device, including packer main part and feeding hopper, the top of packer main part is fixedly connected with feed inlet box, the side of feed inlet box is connected with blow pipe, one end of blow pipe is connected with conveying pipe, one end of conveying pipe is connected with drying assembly, the other side of feed inlet box is fixedly connected with dust extraction assembly, the inner wall of feeding hopper is fixedly connected with pusher assembly, drying assembly includes the heating box being connected at conveying pipe one end, the side of heating box is connected with hair dryer;Dust extraction assembly includes dust cover being fixedly connected on the other side of feed inlet box, the top of dust cover is connected with collecting pipe.The edible peanut kernel even quantity packing device, by the setting of drying assembly and dust extraction assembly, reach effectively remove peanut kernel surface moisture and promote surface cleanliness, further improve storage stability and product quality before packing.