Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

32 results about "Coagulase" patented technology

Coagulase is a protein enzyme produced by several microorganisms that enables the conversion of fibrinogen to fibrin. In the laboratory, it is used to distinguish between different types of Staphylococcus isolates. Importantly, S. aureus is generally coagulase-positive, meaning that a positive coagulase test would indicate the presence of S. aureus. A negative coagulase test would instead show the presence of coagulase negative organisms such as S. epidermidis or S. saprophyticus. However it is now known that not all S. aureus are coagulase-positive.

Isolated broadly reactive opsonic immunoglobulin for treating a pathogenic coagulase-negative staphylococcus infection

The invention describes the identification, making, and isolation of immunoglobulin and antigen useful for preventing, diagnosing, and treating staphylococcal infections. The invention further describes an in vivo animal model useful for testing the efficacy of pharmaceutical compositions, including pharmaceutical compositions of immunoglobulin and isolated antigen.
Owner:THE HENRY M JACKSON FOUND FOR THE ADVANCEMENT OF MILITARY MEDICINE INC

Detection of antibiotic-resistant microorganisms

Method of detecting methicillin-resistant S. aureus (MRSA) and methicillin-sensitive S. aureus (MSSA) in a nucleic acid coamplification assay. The invention advantageously reduces the incidence of false-positive MRSA determinations in real-time assays by requiring satisfaction of a threshold criterion that excludes certain co-infections from the MRSA determination. The invention further provides for determination of MSSA, even when the MSSA is present in combination with methicillin-resistant coagulase-negative (MR-CoNS) bacteria at high or low levels.
Owner:GEN PROBE INC

Staphylococcus antigen and vaccine

A negatively-charged Staphylococcus antigen contains amino acids and a N-acetylated hexosamine as a major carbohydrate component. The antigen is common to many coagulase-negative strains of Staphylococcus, including S. epidermidis, S. haemolyticus, and S. hominis. Staphylococcus strains that carry the antigen include many clinically significant strains of Staphylococcus. The antigen and antibodies to the antigen are useful in kits and assays for diagnosing Staphylococcus infection. Vaccines of the antigen and of whole cells that carry the antigen also are disclosed.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Method of providing polypeptide preparations with reduced enzymatic side activities

InactiveUS20020160445A1Level is reduced and eliminatedHydrolasesChemical treatment enzyme inactivationMicroorganismPepsin inhibitor
A method of providing polypeptide preparations having a reduced content of undesired enzymatic side activities, the method comprising subjecting a medium containing a desired polypeptide such as an enzyme, a pharmaceutically active or immunologically active polypeptide to a pH of less than 2 for a period of time that is required to inactivate the side activities whilst retaining the activity of the desired polypeptide. The method is useful for providing milk clotting enzyme products including rennets or coagulants based on chymosin or pepsin or microbial aspartic proteases e.g. derived from bacterial species and species of filamentous fungi.
Owner:CHR HANSEN AS

Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis

The invention provides a reagent for detecting Yersinia pestis, which comprises an upstream primer, a downstream primer, a fluorescent probe and a quenching probe. The invention also provides a method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis by utilizing the reagent. The primer and the probe are designed according a specific pathogenic gene-plasma coagulase and plasmin original activating factor pla gene on a Yersinia pestis 6MD plasmid; and by carrying out BLAST retrieval with the whole genebank database, the reagent is specific only on a pla gene sequence on Yersinia pestis, has no isogeny with nucleotide sequences of other species and ensures the specificity of the detecting method. The method can realize the amplification and synchronous detection of DNA in the same pipe without carrying out gel electrophoresis analysis after PCR, can finish quantitative detection on a sample in 2 hours or so and has the advantages of simple and convenient operation, high efficiency, high speed and specificity.
Owner:浙江国际旅行卫生保健中心

Identification of bacteria by amplification and probing

A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5′GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5′TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilized on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Owner:KING'S COLLEGE LONDON +1

Beta-lactam compounds and process for preparing the same

A beta-lactam compound of the formula:wherein R1 is lower alkyl or OH-substituted lower alkyl, R2 is H or lower alkyl, X is O, S or NH, n is 1 to 3, R3 is -C(Ra)=NH (Ra is H, lower alkyl or substituted lower alkyl), or a salt thereof, or an ester thereof. These compounds show excellent antibacterial activity against Gram-positive bacteria, particularly against methicillin-resistant Staphylococci and methicillin-resistant and coagulase-negative Staphylococci.
Owner:SUMITOMO DAINIPPON PHARMA CO LTD

Vaginal secretion dry chemical analysis liquid quality control material and preparation method thereof

PendingCN112903986AEliminate the tedious steps of reconstitutionGood effectMicrobiological testing/measurementBiological testingLactate oxidaseWhite blood cell
The invention discloses a vaginal secretion dry chemical analysis liquid quality control material and a preparation method thereof. A corresponding buffer system is prepared first, and then, with the buffer system as a solvent, a plurality of raw materials of a negative quality control material and a positive quality control material are added and dissolved; when different components are added, the next component can be added after the previous component is completely dissolved; in order to ensure the enzyme activity, a liquid negative quality control material and a liquid positive quality control material are prepared in an environment of 4-15 DEG C, and the effect is better; after the preparation is completed, subpackaging and storage are carried out within 24 hours, and quality control can be carried out on 10 items such as coagulase, hydrogen peroxide, lactic acid, oxidase, glucuronidase, N-acetyl hexosaminidase, sialidase, leukocyte esterase, proline aminopeptidase and pH value at the same time, so that the stability is good, the period is long, the use is convenient and fast, complex step of redissolving before the freeze-dried product is used is omitted, and errors caused by redissolving are reduced; and the liquid quality control material has a good practical application value.
Owner:URIT MEDICAL ELECTRONICS CO LTD

A pressure-sensitive self-generating thermogenic plant microbial hot compress and its manufacturing method

The invention discloses a pressure-sensitive autogenous thermogenic plant microbial treatment hot compress patch and a preparation method thereof. The hot compress patch is prepared from blackcurrant,violet herba Violae, radix scrophulariae, radix Angelicae sinensis, radix Paeoniae alba, flos Lonicerae, cactus, vinyl acetate and acrylate. 2-Ethylene Hexyl Ester, 2-Ethyl-4. Functional components obtained by polymerizing methimidazole crosslinking agent, bentonite, corn starch, purified water and absolute ethanol with sufficient amount of saprophytic staphylococcus bacteria, coagulase-negativestaphylococcus bacteria and septococcus luteus bacteria through aqueous monomer copolymerization; The other part is woven fabric made of cotton fibers according to the design of hot compress sticker.The last part is PE plastic sleeve for vacuum packaging. As that pressure-sensitive adhesive of the invention has good adhesion, good skin affinity, spontaneous heat generation, green environmental protection and pollution-free, and obvious moxibustion effect, the pressure-sensitive adhesive is suitable for industrial batch production and self-adhesion, and has pharmaceutical treatment effect andprobiotic microbial health care effect. The pressure-sensitive adhesive of the invention has good adhesion, good skin affinity, self-heat generation, green environmental protection and pollution-free,obvious moxibustion effect, and is suitable for industrial batch production and self-adhesion.
Owner:QINGDAO OPIS DAILY NECESSITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products