Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

33 results about "Coagulase" patented technology

Coagulase is a protein enzyme produced by several microorganisms that enables the conversion of fibrinogen to fibrin. In the laboratory, it is used to distinguish between different types of Staphylococcus isolates. Importantly, S. aureus is generally coagulase-positive, meaning that a positive coagulase test would indicate the presence of S. aureus. A negative coagulase test would instead show the presence of coagulase negative organisms such as S. epidermidis or S. saprophyticus. However it is now known that not all S. aureus are coagulase-positive.

Staphylococcus antigen and vaccine

A negatively-charged Staphylococcus antigen contains amino acids and a N-acetylated hexosamine as a major carbohydrate component. The antigen is common to many coagulase-negative strains of Staphylococcus, including S. epidermidis, S. haemolyticus, and S. hominis. Staphylococcus strains that carry the antigen include many clinically significant strains of Staphylococcus. The antigen and antibodies to the antigen are useful in kits and assays for diagnosing Staphylococcus infection. Vaccines of the antigen and of whole cells that carry the antigen also are disclosed.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Isolated broadly reactive opsonic immunoglobulin for treating a pathogenic coagulase-negative staphylococcus infection

The invention describes the identification, making, and isolation of immunoglobulin and antigen useful for preventing, diagnosing, and treating staphylococcal infections. The invention further describes an in vivo animal model useful for testing the efficacy of pharmaceutical compositions, including pharmaceutical compositions of immunoglobulin and isolated antigen.
Owner:THE HENRY M JACKSON FOUND FOR THE ADVANCEMENT OF MILITARY MEDICINE INC

Microbially derived enzymes having enhanced milk clotting activity and method of producing same

PCT No. PCT / DK95 / 00511 Sec. 371 Date Aug. 14, 1997 Sec. 102(e) Date Aug. 14, 1997 PCT Filed Dec. 20, 1995 PCT Pub. No. WO96 / 19582 PCT Pub. Date Jun. 27, 1996A method of producing a milk clotting enzyme including the steps of (a) fermenting a strain of Rhizomucor miehei or Aspergillus oryzae to form a fermentation product having a glycoslated Rhizomucor miehei aspartic protease and other proteins, and (b) subjecting a quantity of the fermentation product to a deglycosylating treatment to form a coagulant preparation having an at least partly deglycoslated aspartic protease and the other proteins. The at least partly deglycosylated protease has a milk clotting activity that is at least 10% higher than a milk clotting activity of the glycosylated aspartic protease.
Owner:CHR HANSEN AS

Detection of antibiotic-resistant microorganisms

Method of detecting methicillin-resistant S. aureus (MRSA) and methicillin-sensitive S. aureus (MSSA) in a nucleic acid coamplification assay. The invention advantageously reduces the incidence of false-positive MRSA determinations in real-time assays by requiring satisfaction of a threshold criterion that excludes certain co-infections from the MRSA determination. The invention further provides for determination of MSSA, even when the MSSA is present in combination with methicillin-resistant coagulase-negative (MR-CoNS) bacteria at high or low levels.
Owner:GEN PROBE INC

Staphylococcus antigen and vaccine

A negatively-charged Staphylococcus antigen contains amino acids and a N-acetylated hexosamine as a major carbohydrate component. The antigen is common to many coagulase-negative strains of Staphylococcus, including S. epidermidis, S. haemolyticus, and S. hominis. Staphylococcus strains that carry the antigen include many clinically significant strains of Staphylococcus. The antigen and antibodies to the antigen are useful in kits and assays for diagnosing Staphylococcus infection. Vaccines of the antigen and of whole cells that carry the antigen also are disclosed.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Fast hymen Yegenerating repair medicine

The fast hymen regenerating and repairing medicine is prepared with hemoglobin 15-30 weight portions, lecithin 10-20 weight portions, amino acid 15-25 weight portions, albumin glue 2-10 weight portions, notoginseng 2-10 weight portions, saffron 1-8 weight portions, protein 5-15 weight portions, cellulose 10-20 weight portions, and free coagulase 5-15 weight portions. The present invention is used in the local targeting process to provide hymen root cell with nutritious components and active growth elements, to activate cells for division and regeneration and to regenerate hymen. The present invention has excellent treating effect.
Owner:闫娜

Vaginal secretion detection kit and preparation method thereof

The invention discloses a vaginal fluid detection kit, which comprises a reaction device and a color developing agent, wherein the reaction device comprises a reaction hole for detecting beta-glucuronidase, a reaction hole for detecting acetylglucosaminidase, a reaction hole for detecting coagulase and a reaction hole for detecting proline aminopeptidase; when the kit is used for detecting vaginal secretion, the used diluent is normal saline. The vaginal secretion detection kit has the advantage that pathogenic bacteria or pathogens of bacterial vaginal diseases and trichomonas vaginitis can be used for assisting in the fast judgment of the vaginal disease condition. The invention also discloses a preparation method of the vaginal secretion detection kit.
Owner:GUANGZHOU HONGQI OPTICAL INSTR TECH

Coagulogen raw material, process for producing the same, and method and apparatus for measuring physiologically active substance of biological origin using the same

Disclosed is a technique for obtaining a coagulogen raw material which can irreversibly inactivate the activity of a coagulase while retaining the function of coagulogen in an LAL reagent, a LAL reagent contaminated by an organism-derived biologically active substance or the like, and which can be used in a reagent. An LAL reagent is heated at a predetermined temperature for a predetermined period of time to deactivate only the activity of an enzyme contained in the LAL reagent irreversibly, wherein such an activity inherent in coagulogen that coagulogen can be hydrolyzed with the activated coagulase and converted to coagulin to induce gelatinization or an agglutination reaction is retained.
Owner:KOWA CO LTD

Primer and probe composition and kit

The invention discloses a primer and a probe composition and a kit. The primer and probe composition are used for detecting coagulase negative staphylococcus, Staphylococcus aureus and methicillin resistance genes; a coagulase negative staphylococcus detection target is a sodA gene, the staphylococcus aureus detection target is a femA gene, and the methicillin resistance gene is a mecA gene; The primer and probe composition include a forward primer, a reverse primer, and a probe for respectively detecting the sodA gene, the femA gene, and the mecA gene, which are shown as SEQ ID NO. 1 to SEQ ID NO. 9. The primer and a probe composition use real-time fluorescent quantitative PCR to detect the coagulase negative staphylococcus, staphylococcus aureus and methicillin resistance genes. The detection cycle is greatly shortened, the efficiency and the detection flux are improved, the detection requirement is catered for, and the specificity, sensitivity and accuracy are high, at the same time, no detection process is generated after amplification in the experiment, and the pollution problem in the experiment can be effectively solved.
Owner:宁波基内生物技术有限公司

Method of providing polypeptide preparations with reduced enzymatic side activities

InactiveUS20020160445A1Level is reduced and eliminatedHydrolasesChemical treatment enzyme inactivationMicroorganismPepsin inhibitor
A method of providing polypeptide preparations having a reduced content of undesired enzymatic side activities, the method comprising subjecting a medium containing a desired polypeptide such as an enzyme, a pharmaceutically active or immunologically active polypeptide to a pH of less than 2 for a period of time that is required to inactivate the side activities whilst retaining the activity of the desired polypeptide. The method is useful for providing milk clotting enzyme products including rennets or coagulants based on chymosin or pepsin or microbial aspartic proteases e.g. derived from bacterial species and species of filamentous fungi.
Owner:CHR HANSEN AS

Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis

The invention provides a reagent for detecting Yersinia pestis, which comprises an upstream primer, a downstream primer, a fluorescent probe and a quenching probe. The invention also provides a method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis by utilizing the reagent. The primer and the probe are designed according a specific pathogenic gene-plasma coagulase and plasmin original activating factor pla gene on a Yersinia pestis 6MD plasmid; and by carrying out BLAST retrieval with the whole genebank database, the reagent is specific only on a pla gene sequence on Yersinia pestis, has no isogeny with nucleotide sequences of other species and ensures the specificity of the detecting method. The method can realize the amplification and synchronous detection of DNA in the same pipe without carrying out gel electrophoresis analysis after PCR, can finish quantitative detection on a sample in 2 hours or so and has the advantages of simple and convenient operation, high efficiency, high speed and specificity.
Owner:浙江国际旅行卫生保健中心

Monoclonal antibodies against the pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum

The present invention relates to monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a, including pathogenic species such as the methyciline-resistant Staphylococcus Aureus (MRSA), coagulase-negative Staphilococcus, Staphylococcus sciuri and Enterococcus, and any other bacteria containing the PBP2-a protein or homologous sequences. The invention also relates to the use of the monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequenceshomologous to PBP2-a in a complementary immunodiagnostic test for detecting resistance to beta-lactam antibiotics.
Owner:FUNDACAO OSWALDO CRUZ FIOCRUZ

Eight-joint detection kit for vaginitis

The invention discloses an eight-joint detection kit for vaginitis. The eight-joint detection kit is characterized by comprising a reaction plate and (2) a diluent, wherein the reaction plate is provided with reaction holes for detecting the following indexes: beta-glucuronidase, coagulase, hydrogen peroxide, neuraminidase, leukocyte esterase, acetamido-beta-glucosidase, proline aminopeptidase andpH. The kit aims to solve the problem that aerobic bacterial vaginitis, bacterial vaginitis, trichomonas vaginitis and mycotic vaginitis cannot be detected at the same time, and meanwhile, the problem that the kit is poor in detection precision is solved.
Owner:青岛华晶生物技术有限公司

Identification of bacteria by amplification and probing

A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5′GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5′TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilized on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Owner:KING'S COLLEGE LONDON +1

Processing method for promoting red color improvement of fermented sausage

The invention relates to a processing method for promoting red color improvement of fermented sausages, and belongs to the technical field of meat science in food science. According to the method disclosed by the invention, the fermented sausage inoculated with coagulase-negative staphylococcus is treated by low-intensity high hydrostatic pressure, and is fermented, so that the redness value of the sausage finished product reaches 6.5-7.0. When in use, the inoculum size of the coagulase-negative staphylococcus in sausage meat is 106-108 CFU / g meat; the high hydrostatic pressure treatment pressure is 200-300 MPa, and the treatment time is 3-7 min. The low-intensity high hydrostatic pressure treatment improves the expression quantity of nitric oxide synthase in coagulase-negative staphylococcus so as to promote the yield of nitrosomyoglobin in the fermented sausage and improve the color and luster of the fermented sausage. According to the processing method disclosed by the invention, the color and luster of the fermented sausage are effectively improved, a feasible scheme is provided for color development substitution of nitrite in the fermented sausage, and the requirements of people on healthy and safe fermented sausage products are met.
Owner:HEFEI UNIV OF TECH

Beta-lactam compounds and process for preparing the same

A beta-lactam compound of the formula:wherein R1 is lower alkyl or OH-substituted lower alkyl, R2 is H or lower alkyl, X is O, S or NH, n is 1 to 3, R3 is -C(Ra)=NH (Ra is H, lower alkyl or substituted lower alkyl), or a salt thereof, or an ester thereof. These compounds show excellent antibacterial activity against Gram-positive bacteria, particularly against methicillin-resistant Staphylococci and methicillin-resistant and coagulase-negative Staphylococci.
Owner:SUMITOMO DAINIPPON PHARMA CO LTD

Beta-lactam compounds and process for producing the same

Novel beta-lactam compound of the formula [1]:wherein R1 is lower alkyl or hydroxy-substituted lower alkyl, R2 is H or lower alkyl, X is O or, S, R3 is H, metal or protecting group, W is a 6- or 7-membered nitrogen-containing heterocycle optionally being substituted at carbon atoms. Said beta-lactam compound shows excellent antibacterial activity against Gram-positive bacteria, particularly against methicillin-resistant Staphylococcus aureus and methicillin-resistant and coagulase-negative Staphylococcus aureus.
Owner:SUMITOMO DAINIPPON PHARMA CO LTD

Combined detection kit for detecting and identifying candida and trichomonias

The invention discloses a joint detection kit for detecting and distinguishing Trichomonas and Candida, which comprises coagulation enzyme activity detection reagent, α-glucosidase activity detection reagent and pH detection reagent; the enzyme substrate used in the coagulation enzyme activity detection reagent The substance is a Gly-Arg dipeptide substrate containing a chromogen or a fluorescent group; the enzyme substrate used in the α-glucosidase activity detection reagent is an α-D-glucoside substrate containing a chromogen or a fluorescent group . In order to improve the color developing effect, it may also include a color developing solution. The invention has the advantages of relatively high sensitivity and specificity, significantly improved performance of reagents compared with the existing similar methods, and can meet the needs of clinical detection.
Owner:AUTOBIO DIAGNOSTICS CO LTD

Vaginal secretion dry chemical analysis liquid quality control material and preparation method thereof

PendingCN112903986AEliminate the tedious steps of reconstitutionGood effectMicrobiological testing/measurementBiological testingLactate oxidaseWhite blood cell
The invention discloses a vaginal secretion dry chemical analysis liquid quality control material and a preparation method thereof. A corresponding buffer system is prepared first, and then, with the buffer system as a solvent, a plurality of raw materials of a negative quality control material and a positive quality control material are added and dissolved; when different components are added, the next component can be added after the previous component is completely dissolved; in order to ensure the enzyme activity, a liquid negative quality control material and a liquid positive quality control material are prepared in an environment of 4-15 DEG C, and the effect is better; after the preparation is completed, subpackaging and storage are carried out within 24 hours, and quality control can be carried out on 10 items such as coagulase, hydrogen peroxide, lactic acid, oxidase, glucuronidase, N-acetyl hexosaminidase, sialidase, leukocyte esterase, proline aminopeptidase and pH value at the same time, so that the stability is good, the period is long, the use is convenient and fast, complex step of redissolving before the freeze-dried product is used is omitted, and errors caused by redissolving are reduced; and the liquid quality control material has a good practical application value.
Owner:URIT MEDICAL ELECTRONICS CO LTD

Monoclonal antibodies against the pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum

The present invention relates to monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a, including pathogenic species such as the methyciline-resistant (MRSA), coagulase-negative, and , and any other bacteria containing the PBP2-a protein or homologous sequences. The invention also relates to the use of the monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a in a complementary immunodiagnostic test for detecting resistance to beta-lactam antibiotics.
Owner:FUNDACAO OSWALDO CRUZ FIOCRUZ

A pressure-sensitive self-generating thermogenic plant microbial hot compress and its manufacturing method

The invention discloses a pressure-sensitive autogenous thermogenic plant microbial treatment hot compress patch and a preparation method thereof. The hot compress patch is prepared from blackcurrant,violet herba Violae, radix scrophulariae, radix Angelicae sinensis, radix Paeoniae alba, flos Lonicerae, cactus, vinyl acetate and acrylate. 2-Ethylene Hexyl Ester, 2-Ethyl-4. Functional components obtained by polymerizing methimidazole crosslinking agent, bentonite, corn starch, purified water and absolute ethanol with sufficient amount of saprophytic staphylococcus bacteria, coagulase-negativestaphylococcus bacteria and septococcus luteus bacteria through aqueous monomer copolymerization; The other part is woven fabric made of cotton fibers according to the design of hot compress sticker.The last part is PE plastic sleeve for vacuum packaging. As that pressure-sensitive adhesive of the invention has good adhesion, good skin affinity, spontaneous heat generation, green environmental protection and pollution-free, and obvious moxibustion effect, the pressure-sensitive adhesive is suitable for industrial batch production and self-adhesion, and has pharmaceutical treatment effect andprobiotic microbial health care effect. The pressure-sensitive adhesive of the invention has good adhesion, good skin affinity, self-heat generation, green environmental protection and pollution-free,obvious moxibustion effect, and is suitable for industrial batch production and self-adhesion.
Owner:QINGDAO OPIS DAILY NECESSITIES

Human sepsis pathogen detection kit and detection method

The invention provides a human sepsis pathogen detection kit and a corresponding detection method. The kit provided by the invention comprises primers and fluorescent probes fordetecting acinetobacter baumannii, klebsiella pneumoniae, streptococcus pneumoniae, bacteroides fragilis, staphylococcus aureus, pseudomonas aeruginosa, aeromonas hydrophila, escherichia coli, quail chicken enterococcus, enterobacter cloacae, stenotrophomonas maltophilia, coagulase negative staphylococcus, candida albicans, candida tropicalis, candida glabrata, cytomegalovirus, human herpesvirus type 4, human parvovirus B19, Candida parapsilosis, streptococcus.
Owner:重庆市急救医疗中心重庆市第四人民医院重庆市急救医学研究所 +1

In-vitro inflammation model of dairy cow mammary epithelial cells as well as construction method and application of in-vitro inflammation model

PendingCN114717180AOptimize and determine detection indicatorsModel stabilityMicrobiological testing/measurementDrug screeningBiotechnologyMilk cow's
The invention provides an in-vitro inflammation model of dairy cow mammary epithelial cells. The in-vitro inflammation model is an injury pathological model of coagulase negative staphylococcus infected dairy cow mammary epithelial cells. According to the invention, cow mammary epithelial cells are taken as a research object, a method for infecting cow mammary epithelial cells with coagulase-negative staphylococcus by taking cow mammary epithelial cells as a carrier is established, an in-vitro inflammation model for simulating bacterial infection of cow mammary cells is established, and proper infection complex number MOI and infection time are determined; and optimizing and determining the detection index of the coagulase-negative staphylococcus infected cow mammary epithelial cells. The model is stable and reliable, and lays a foundation for in-vitro drug screening research on cow mastitis caused by bacteria, especially coagulase-negative staphylococcus, and pathogenic mechanism research on bacteria, especially coagulase-negative staphylococcus.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

Monoclonal antibodies against the pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum

The present invention relates to monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a, including pathogenic species such as the methyciline-resistant Staphylococcus Aureus (MRSA), coagulase-negative Staphilococcus, Staphylococcus sciuri and Enterococcus, and any other bacteria containing the PBP2-a protein or homologous sequences. The invention also relates to the use of the monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a in a complementary immunodiagnostic test for detecting resistance to beta-lactam antibiotics.
Owner:FUNDACAO OSWALDO CRUZ FIOCRUZ

Coagulase negative staphylococcus selective medium and preparation method thereof

The invention discloses a coagulase negative staphylococcus selective medium and a preparation method thereof. The coagulase negative staphylococcus selective medium and the preparation method are used in the field of inspection and susceptibility testing. The coagulase negative staphylococcus selective medium is characterized in that a formula for preparing 1000ml of the selective culture medium comprises the following components: 15g of malt extract, 150ml of egg protein fluid, 5g of sodium chloride, 0.5g of magnesium citrate, 15g of agar, 8-12mg of coetsoidin A, 3.6g of asparagine, 0.2g of monopotassium phosphate and distilled water added to 1000ml. The preparation method of the best optimization formula comprises the following steps of: dissolving the malt extract, the egg protein fluid, sodium chloride, magnesium citrate, the agar, the coetsoidin A, the asparagine, the monopotassium phosphate, L-cysteic acid and copper sulfate to lily decocted liquid, uniformly mixing, metering volume and split charging after sterilization. Compared with the prior art, the method has the characteristics of being reliable to detect and high in separation rate of coagulase negative staphylococcus.
Owner:孟蕾蕾

Kit for detecting aerobic bacteria in vaginal discharge and preparation method thereof

The invention provides a kit for detecting aerobic bacteria in vaginal discharge, a dried kit comprises a reactor for detecting the enzyme activity of beta-glucuronidase and coagulase and color-developing agent, and a humidified kit comprises beta-glucuronidase substrate solution, coagulase substrate solution and color-developing agent. The invention also provides a preparation method of the kit.The kit in the invention directly identifies the aerobic flora, in particular to the aerobic floras such as staphylococcus aureus, Enterococcus faecalis, streptococcus group B, Escherichia coli and the like which can cause aerobic bacteria vaginalitis in vaginal discharge by detecting the activity of beta-glucuronidase and coagulase. The method has simple, convenient and rapid operation and high accuracy, and is suitable for convention application in clinics especially in hospital outpatient.
Owner:北京中生金域诊断技术股份有限公司

A kit for detecting bacterial flora in vaginal secretions and its preparation method

The invention provides an AV / BV joint detection kit, which is composed of a reaction device, a sample diluent, a chromogenic agent A and a chromogenic agent B, wherein the reaction device is provided with a hydrogen peroxide reaction hole, a sialidase reaction Well, white blood cell esterase reaction well, β-glucuronidase reaction well and coagulation enzyme reaction well, there are corresponding reaction pads in the reaction well. The invention also provides a preparation method of the detection kit. The detection kit of the present invention can directly identify the aerobic bacteria / Anaerobic bacteria and facultative anaerobic bacteria and other flora, the method is simple, fast, and highly accurate, and is suitable for routine clinical use, especially in outpatient clinics.
Owner:北京中生金域诊断技术股份有限公司

Coagulogen raw material, process for producing the same, and method and apparatus for measuring physiologically active substance of biological origin using the same

Disclosed is a technique for obtaining a coagulogen raw material which can irreversibly inactivate the activity of a coagulase while retaining the function of coagulogen in an LAL reagent, a LAL reagent contaminated by an organism-derived biologically active substance or the like, and which can be used in a reagent. An LAL reagent is heated at a predetermined temperature for a predetermined period of time to deactivate only the activity of an enzyme contained in the LAL reagent irreversibly, wherein such an activity inherent in coagulogen that coagulogen can be hydrolyzed with the activated coagulase and converted to coagulin to induce gelatinization or an agglutination reaction is retained.
Owner:KOWA CO LTD

A kind of human sepsis pathogen detection kit and detection method

The invention provides a detection kit for human sepsis pathogens and a corresponding detection method. The kit of the present invention includes detection of Acinetobacter baumannii, Klebsiella pneumoniae, Streptococcus pneumoniae, Bacteroides fragilis, Staphylococcus aureus, Pseudomonas aeruginosa, Aeromonas hydrophila, Escherichia coli bacteria, Enterococcus gallinarum, Enterobacter cloacae, Stenotrophomonas maltophilia, Coagulase-negative Staphylococcus, Candida albicans, Candida tropicalis, Candida glabrata, Cytomegalovirus, Human herpesvirus type IV , Human parvovirus B19, Candida parapsilosis, Streptococcus primers and fluorescent probes.
Owner:重庆市急救医疗中心重庆市第四人民医院重庆市急救医学研究所 +1