25 results about "Echinococcoses" patented technology

The invention relates to the technical field of tapeworm identification, and provides a kit for identifying five target tapeworms by using specific primers and application of the kit. All mainstream genotypes of genes of Echinococcus granulosus, Echinococcus multilocularis, Taenia vesicula, Taenia multiceps and Taenia canis are compared, and a primer pair capable of universally detecting nucleic acids of five tapeworms is obtained by taking conserved regions of the genes as diagnostic targets. The rapid detection of the five pathogens is realized by combining with a digoxin-labeled nucleic acid lateral chromatography test paper. A product obtained by isothermal amplification is detected by a nucleic acid detection test strip and then is directly observed by eyes, and the result is interpreted within 15-20 minutes, so that the operation is simple and convenient. The method provided by the invention has wide application prospects in the aspects of large-scale screening and detection of whether dogs are infected with echinococcus granulosus, echinococcus multilocularis, taenia vesicula, taenia multiceps and tapestoma dogs or not in pasturing areas, especially in areas with epidemic echinococcosis, and evaluation of the insect expelling effect of the dogs fed with praziquantel on the tapeworms.

The invention belongs to the technical field of biological detection, and particularly discloses a pair of echinococcosis detection markers based on serum circulating miRNA and application of the echinococcosis detection markers, the detection markers are a combination of miR-192-5p and miR-122-5p, the abundance of the miR-192-5p and the miR-122-5p in the serum of an echinococcosis patient is remarkably reduced, the miR-192-5p and the miR-122-5p are in negative correlation with echinococcosis infection, and the threshold values are 0.35 and 0.04 respectively. During detection, the relative expression level (taking caenorhabditis elegans miR-39-3p as an external reference) of caenorhabditis elegans miR-39-3p in serum is determined through qPCR, and the positive and negative properties are judged according to a threshold value; the area under the ROC curve of the marker combination reaches 0.97, and a double-blind test shows that the positive rate and the negative rate of human and mouse serum detection are 100%. The method solves the problems of missed diagnosis and misdiagnosis in existing echinococcosis detection, can be used for preparing a detection kit, realizes accurate detection, curative effect evaluation and prognosis management of echinococcosis, and has extremely high clinical application value.

The application discloses a liver damage model caused by echinococcosis and a lesion tissue positioning method, which comprises an image acquisition module, a processor, a memory and a display which are connected with each other. On the basis of a three-dimensional liver ultrasonic image, after image gray processing, convolution operation is carried out, and the three-dimensional image is divided into two-dimensional images which are easy to process. Through feature extraction and data type merging, division of different liver tissue regions is realized, and whether liver echinococcosis is alive or not can be accurately judged, meanwhile, false points are eliminated, lesion tissue judgment efficiency is higher, precise positioning of lesion tissue can be realized, judgment can be realized without the help of professional knowledge of medical staff, treatment efficiency is high, and surgical risk is low.

The application discloses a PSAP-3 protein fragment and application thereof in human echinococcosis. The polypeptide comprises an amino acid sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. The application further discloses a recombinant protein or a mutation thereof, wherein the recombinant protein comprises an amino acid sequence as shown in SEQ ID NO:5, and the amino acid sequence of the mutation has at least 80% identity with the amino acid sequence of the recombinant protein. The immunoreaction rate of the PSAP-3 recombinant protein of the application is 100%, the echinococcosis can be effectively detected, the positive detection rate is 96%, the negative detection rate is 90%, and the positive patient that cannot be detected by Egr can be detected.

The invention relates to a hepatic echinococcosis focus identification and classification method based on deep learning. The method comprises the following steps: when a focus exists in a to-be-detected liver ultrasonic image, generating focus detection state information of each focus in the to-be-detected liver ultrasonic image, and for any focus, when the pathological type of the focus is benign, performing coarse classification detection on the focus in a focus detection frame to generate coarse classification information of the focus; for any lesion, when the coarse classification information of the lesion is cystic hydatid type or vesicular hydatid type, determining that the lesion is a hepatic echinococcosis lesion, and performing hydatid subdivision category detection and lesion contour segmentation on the lesion to determine a corresponding hydatid subdivision category when the lesion belongs to the cystic hydatid type or vesicular hydatid type, and if the lesion belongs to the vesicular hydatid type or vesicular hydatid type, determining that the lesion belongs to the hepatic echinococcosis lesion. And a target contour of the lesion. According to the invention, the identification and classification of the hepatic echinococcosis can be effectively realized, and the precision and reliability of hepatic echinococcosis detection are improved.

The invention belongs to the field of molecular biology detection, specifically relates to detection of echinococcosis, and more specifically relates to detection of echinococcosis typing and / or prognosis. The composition provided by the invention has the advantages of higher detection sensitivity (up to 500 copies / mL), good specificity and more accurate detection, provides more sufficient and rapid diagnosis for clinicians, shortens the time of the clinicians for diagnosing the condition of a patient, and accelerates the implementation of treatment measures on the patient.

The application relates to the technical field of echinococcosis medicines, and is an application of a Toll-like receptor agonist Resiquimod in preparation of an echinococcosis treatment medicine. The application discloses, for the first time, the application of the Toll-like receptor agonist Resiquimod in preparation of the echinococcosis treatment medicine. The Toll-like receptor agonist Resiquimod can promote the fibrosis of the tissue around a lesion of a mouse infected with multilocular metacestode and further inhibit the growth of the multilocular metacestode, and reduce the lesion volume of the liver of the mouse infected with the multilocular metacestode, thereby providing a new way for echinococcosis treatment.

The invention relates to the technical field of molecular biology detection, in particular to a cattle and sheep universal type echinococcosis ELISA diagnostic kit and application thereof.The cattle and sheep universal type echinococcosis ELISA diagnostic kit comprises an SPG-HRP conjugate, the SPG-HRP conjugate is obtained by coupling SPG recombinant protein and horse radish peroxidase, the SPG recombinant protein comprises r2CSPG and r3CSPG, the amino acid sequence of the r2CSPG recombinant protein is shown as SEQ ID NO.1, the amino acid sequence of the r3CSPG recombinant protein is shown as SEQ ID NO.2, and the amino acid sequence of the r3CSPG recombinant protein is shown as SEQ ID NO.2. The amino acid sequence of the r3CSPG recombinant protein is as shown in SEQ ID NO. 2. The problem of how to apply the streptococcus protein G to early screening and early diagnosis of echinococcosis is solved.

The application discloses a VAT1L protein fragment and application thereof in human echinococcosis detection. The polypeptide comprises one or more of the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5. The application further discloses a recombinant protein or a mutation thereof, wherein the recombinant protein comprises an amino acid sequence shown in SEQ ID NO:6; the amino acid sequence of the mutation has at least 80% identity with the amino acid sequence of the recombinant protein and maintains the function of the recombinant protein. The immunoreaction rate of the VAT1L recombinant protein is 56%, the echinococcosis can be effectively detected, the positive detection rate is 82%, the negative detection rate is 84%, and the positive cases that cannot be detected by Egr can be detected.

This invention provides an animal model of hepatic echinococcosis caused by *Echinococcus multilocularis*, its construction method, and its applications. The construction method mainly includes preserving the protoscolex, extracting the protoscolex of *Echinococcus multilocularis*, and injecting the preserved protoscolex into C57BL / 6N mice. The resulting mouse model can be used to observe the infection and development of hepatic echinococcosis, and to screen and / or evaluate hepatic echinococcosis drugs. The advantages of this invention are that it explores the growth pattern of *Echinococcus multilocularis* and its impact on the hepatic vascular system from a novel perspective. Furthermore, addressing the problems of complex and high-risk traditional modeling methods, it proposes an optimized liver-targeted inoculation pathway and establishes a standardized pathogen treatment process, ensuring infection success rate and animal survival rate while reducing experimental interference factors.

The present application relates to a kind of echinococcus Eg95 protein, nucleotide and mRNA for coding the protein of the present application.By optimizing echinococcus Eg95 protein amino acid and nucleotide sequence, echinococcus circular RNA vaccine, echinococcus linear mRNA vaccine and echinococcus self-replicating mRNA vaccine are prepared, the vaccine can provide strong immune protection to 4-month-old lambs only one needle immunization, so that it can still obtain more than 80% protection (higher than 70% required by Ministry of Agriculture and Rural Affairs) on the 180th day after immunization, solve the problem that commercial sheep echinococcosis genetic engineering subunit vaccine immunity is weak, and frequent vaccination is needed to obtain immune protection, reduce the repeated burden of vaccine procurement and labor cost, reduce the stress response to sheep flock, improve vaccination coverage and compliance, and be conducive to the prevention and control of our country hydatid disease.

The invention relates to the technical field of in-vitro diagnosis, and discloses an EB virus and echinococcosis antibody joint detection magnetic immunofluorescence detection micro-fluidic chip which comprises a chip body, the chip body is provided with a sample adding chamber, a liquid separation pool and a detection cavity which are communicated in sequence, and the chip body is further provided with a detergent chamber and a waste liquid pool; the detergent chamber is connected with the detection cavity through a washing valve; a hydrophobic modified layer is arranged on the surface of the inner wall of the washing valve; the opening rotating speed threshold value of the washing valve is higher than the centrifugal rotating speed for realizing plasma separation in the liquid separation pool; and one-step immunoreaction freeze-dried microspheres are preset in the detection cavity. According to the invention, a fluid control switch with a high opening threshold value for a liquid containing a surfactant is constructed by arranging a hydrophobic coating with a specific geometric size at the washing valve, so that the problem that the flow is out of control is solved, and the time sequence accuracy of a multi-step reaction is ensured.

The application discloses a UP protein fragment and application thereof in human echinococcosis. The polypeptide comprises one or more of the amino acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9. The application further discloses application of the polypeptide or the marker combination in preparation of an antibody against echinococcosis or a diagnostic agent for diagnosing a disease caused by echinococcus granulosus. The new antigen UP of echinococcus in the application can be used to prepare an ELISA kit and used for clinical detection of human echinococcosis, and can be purified in a large amount, thereby facilitating large-scale screening of human echinococcosis.

This invention relates to the fields of biotechnology and parasite control technology, and proposes an enzyme that can promote the death of echinococcosis protocercariae in an acidic environment. This enzyme is a synthetic enzyme with the amino acid sequence SEQ ID NO:1. This invention achieves precise intervention in key links of echinococcosis transmission through synthetic enzyme technology, possessing high efficiency, safety, and feasibility, and has significant public health and veterinary application value.

The present application relates to the technical field of disease distribution prediction, and discloses a method and system for predicting the spatial distribution of alveolar echinococcosis based on multi-source environmental factors, comprising: obtaining multi-source environmental data of alveolar echinococcosis case points in a study area, processing the multi-source environmental data, and screening key environmental factors; obtaining a data set of sample points based on the key environmental factors, and dividing the data set into a training set and a test set; selecting a spatial prediction model, training and testing the spatial prediction model based on the training set and the test set, and obtaining an alveolar echinococcosis spatial prediction model; dividing the study area into a plurality of geographic units, obtaining the incidence probability of alveolar echinococcosis of each geographic unit based on the alveolar echinococcosis spatial prediction model, and determining the risk level. The present application can accurately predict the spatial distribution of alveolar echinococcosis by comprehensively considering multi-source environmental factors.

The utility model relates to the field of echinococcosis detection, in particular to a rapid echinococcosis detection device which comprises a workbench, an installation frame is vertically arranged on the upper surface of the workbench, a plurality of placing columns are evenly and vertically arranged on the upper surface of the workbench and located on one side of the installation frame, and an echinococcosis detection plate is horizontally placed on the tops of the placing columns. By means of the downward pressing mechanism, a sample solution in the infusion cylinder can be rapidly dripped out, the dripping amount can be controlled, the driving mechanism is matched with the placement rotating disc, the infusion cylinder can be rapidly switched, and when a new sample solution is detected, the sample solution can be rapidly detected, so that the detection efficiency is improved, and the detection cost is reduced. When a plurality of sample solutions are detected, the rotation of the placing turntable can be realized only through the driving mechanism, so that the detection efficiency is higher, and the time for replacing, cleaning and disinfecting the infusion cylinder is not needed.

The invention discloses a method for intervening growth of echinococcus multilocularis based on diapause pheromone Ascr # 18 and application, and belongs to the technical field of prevention and control of zoonosis parasitic diseases. According to the invention, the Ascr # 18 is identified in the echinococcus multilocularis through liquid chromatography-mass spectrometry (LC-MS) for the first time, and it is verified that the Ascr # 18 can be combined with a downstream G-protein coupled receptor (GPCR) in a high-affinity manner, and a signal channel is activated. After the Ascr # 18 is treated, the expression level of development key genes daf-9 and daf-12 in the protoscolex of the echinococcus multilocularis can be remarkably reduced, and the movement activity of the development key genes daf-9 and daf-12 is inhibited, so that the development process and infection ability of parasites are blocked. The invention provides a novel biological prevention and control strategy which does not depend on traditional chemical anthelmintic drugs, is high in targeting, high in safety, environment-friendly and controllable, is suitable for comprehensive prevention and control of alveolar echinococcosis, and can also provide a theoretical basis and an application reference for prevention and control of other tapeworm and larva parasitic diseases.

The invention relates to the technical field of gene inhibitors, in particular to an RAB7B gene inhibitor and application of the RAB7B gene inhibitor in preparation of drugs for preventing and / or treating echinococcosis. The invention discloses the application of the RAB7B gene inhibitor in the aspects of prevention and treatment of echinococcosis for the first time, and experiments prove that the expression of the RAB7B gene can be remarkably up-regulated by echinococcosis cyst fluid, the EGFR (epidermal growth factor receptor) level can be increased after the echinococcosis cyst fluid interferes with the RAB7B gene, and the inflammatory response of macrophages is promoted along with the remarkable increase of inflammation-related factors (CCL5, IFN-beta and IL-6) in the macrophages. Based on the discovery, the invention provides a treatment strategy for enhancing the host anti-hydatid immune response by inhibiting RAB7B gene expression, and provides a new target and a new drug development direction for immunotherapy of echinococcosis.

The invention relates to an EG95-PA fusion protein and application thereof, and belongs to the technical field of biology. The EG95-PA fusion protein is obtained by connecting the sequence-optimized EG95 protein with the sequence-optimized PA protein through the connecting peptide, and the vaccine prepared from the EG95-PA fusion protein can prevent echinococcosis and anthracnose at the same time, and is good in safety, better in immune effect and free of any side effect.

This invention relates to the fields of medicinal chemistry and biotechnology, and proposes a method for improving the resolution efficiency of drugs used to treat echinococcosis, comprising the following steps: Step 1: Praziquantel is reacted with a designed enzyme in a buffer solution containing Fe²⁺ for enzymatic reaction; Step 2: After removing the enzyme protein, the pH is adjusted to 1.0 for crystallization; Step 3: The praziquantel enzymatic reaction product detection solution is freeze-dried in a carbon dioxide incubator until the total amount of praziquantel and its derivatives is 350 mg / L, and then the pH is adjusted to 1.0 with 2 mol / L hydrochloric acid under ice bath conditions to obtain precipitated levamisole crystals. This invention achieves selective catalytic modification of dextrorotatory praziquantel using a genetically engineered specific enzyme while leaving levamisole almost unaffected, significantly improving the resolution efficiency of praziquantel.

The invention discloses a nucleic acid molecular probe, a system and a screening method for specifically recognizing AE echinococcosis people, and relates to the technical field of molecular probes, the nucleic acid molecular probe comprises a nucleic acid molecular probe, and the nucleotide sequence shown by the nucleic acid molecular probe is SEQ ID No.1: CGGGAAGGGTGAGTGGAGAGGTAGTAGTCAGTTGCGCGTCCCGCTAAGG. The application has the effect of realizing efficient specific recognition so as to achieve the purpose of rapidly detecting AE echinococcosis.

The application discloses an exhaled gas VOCs marker for early diagnosis of alveolar echinococcosis and application thereof. The ROC curve AUC of biomarker A myristic acid is 0.965, the sensitivity and the specificity can reach 98.2% and 89.7% respectively, and the accuracy reaches 93.8%; the ROC curve AUC of biomarker B p-tolualdehyde is 0.964, the sensitivity and the specificity can reach 94.5% and 92.3% respectively, and the accuracy reaches 93.3%; the ROC curve AUC of biomarker C 2-(hydroxymethyl)-benzoic acid is 0.961, the sensitivity and the specificity can reach 96.4% and 76.9% respectively, and the accuracy reaches 86.7%. The three kinds of gas levels all have statistical significance, and can be used as a reference basis for diagnosis of AE. The detection system is low in cost, simple in operation and capable of being used for an early screening diagnosis method of alveolar echinococcosis.

The application discloses a method for interfering with the growth of multilocular echinococcosis based on diapause pheromone Ascr#18 and application thereof, and belongs to the technical field of prevention and control of parasitic zoonosis. daf-9 With daf-12 The application discloses a method for interfering with the growth of multilocular echinococcosis based on diapause pheromone Ascr#18 and application thereof, and belongs to the technical field of prevention and control of parasitic zoonosis. The application discloses a method for interfering with the growth of multilocular echinococcosis based on diapause pheromone Ascr#18 and application thereof, and belongs to the technical field of prevention and control of parasitic zoonosis. The application provides a novel biological prevention and control strategy which is independent of traditional chemical deworming drugs, has high targeting, high safety, is environment-friendly and controllable, and is suitable for comprehensive prevention and control of alveolar echinococcosis, and can also provide a theoretical basis and application reference for prevention and control of other cestode larva parasitic diseases.

This invention discloses a method for constructing a knowledge graph of echinococcosis based on a joint extraction model and its application. The steps include: 1. defining the schema of the echinococcosis knowledge graph; 2. constructing a training dataset for echinococcosis; 3. constructing a joint extraction model for echinococcosis information; 4. training the joint extraction model for echinococcosis information and constructing the echinococcosis knowledge graph. This invention designs a joint extraction model tailored to the characteristics of echinococcosis literature corpora and employs multiple optimization strategies to address the issues of entity nesting and relation overlap in sentences within echinococcosis literature. This significantly improves the extraction performance of the joint extraction model for knowledge triples from echinococcosis literature, ensuring that the constructed echinococcosis knowledge graph covers echinococcosis information completely and comprehensively.