Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

97 results about "Bacillus enteritidis" patented technology

Method and composition for reducing E. coli disease and enhancing performance

Bacillus strains that inhibit pathogenic swine E. coli and / or improve performance are provided. Inhibition of pathogenic swine E. coli decreases E. coli disease. At least one strain enhanced swine performance by improving average daily gain, feed efficiency, and feed intake. Preferred Bacillus strains are of species that are included on the GRAS list. Bacillus species are sporeformers and therefore are highly stable and can be fed to swine.
Owner:AGTECH PRODS

Bacillus pumilus laccase gene as well as expression and application thereof

InactiveCN103320453AIncrease productionEasy to meet industrial application requirementsBacteriaMicroorganism based processesEscherichia coliBacillus pumilus
The invention relates to a bacillus pumilus (Bacillus pumilus) L-9 laccase gene cotA as well as recombinant expression and application thereof, belonging to the field of bioengineering. The cotA is separated from the bacillus pumilus (Bacillus pumilus) L-9, an expression vector pColdII-cotA is constructed, and an escherichia coli expression strain BL21(DE3) is transformed to realize high-efficiency expression. The obtained recombinase laccase has the advantages of high alkaline environment resistance and high high-temperature resistance, has a good effect of discoloring azo dyes and anthraquinone dyes and has high application potential.
Owner:JIANGNAN UNIV

Food-originated pathogenic bactenium quick detection gene chip and its application

The present invention provides a gene chip for quickly detecting pathogens from food source, discloses the preparation method of said gene chip and provides 26 oligonucleotide probe sequences for detection. Said gene chip can quickly, accurately and high-effectively detect and identify the class of the pathogens in food, and its detection range includes staphylococcus aureus, Shiga's bacillus, salmonella, colibacillus 0157, bacillus proteus, mononuclear hyperplastic listerella, enterocolitis yersinia, aeruginous pseudomonads, vibrio parahaemolyticus, vibrio cholerae, bacillus cereus, beta hemolytic streptococcus, coconut fermentation pseudomonads, boticin, vibrio jejuni and bacillus perfringens, etc.
Owner:INST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL

Multi-PCR fast detecting reagent kit for salmonella and bacillus coli 0157 in livestock and poultry meat and testing method thereof

The invention relates to a microbial detection device and a detection method of meat of livestock and poultry. The salmonella and Escherichia coli O157 multiple PCR rapid detection kit of the meat of livestock and poultry includes: 10 multiplied by PCR buffer, 1.0 to 3.0mmol / L of MgCl2, 240 Mumol / L of dNTP each, 200nmol / L of salmonella primer, 200nmol / L of Escherichia coli O157 primer and 1.3 to 3.0U of Taq enzyme. The microbial detection device has better specificity, which can complete the simultaneous detection of the salmonella and the Escherichia coli O157 within 8 to 9h; compared with the conventional bacteriology, the diagnosis is rapid, convenient and economical, thus providing a powerful technical means for the diagnosis of pathogen in a food sample and having good application prospect.
Owner:GUANGDONG INST OF MICROORGANISM

Clone, expression and application for lactic acid bacteria glutamic acid decarboxylase gene

The invention discloses a colony, expression and appliance of lactic acid bacteria aminoglutaric acid decarboxylase gene in food industry biotechnics domain, which is characterized by the following: coming from spittle streptococcus thermophilic subspecies (Streptococcus thermophilus) with length at 1380bp; augmenting from gene group DNA through PCR; adding NcoI and EcoRI on the two ends of the gene; limiting enzyme identification sequence; connecting to pET-DsbA of same limited enzyme alimentary; transforming expressing host bacteria BL21(DE3)pLysS of bacillus coli; realizing retooling expression in bacillus coli; getting glutamic acid decarboxylase molecule with molecular weight at 52. 4kDa; transforming L- glutamic acid decarboxylase to gamma-aminobutyric acid with retooling enzyme; providing a great amount of and high active rough enzyme for enzymatical synthesis of gamma-aminobutyric acid; decreasing cost of enzymatical synthesis of gamma-aminobutyric acid. This method possesses warm condition, which belongs to biological synthesis method.
Owner:NANJING AGRICULTURAL UNIVERSITY

Enteric bacilli with fixing effect on cadmium capable of promoting plant growth and application of enteric bacilli

The invention discloses enteric bacilli with a fixing effect on cadmium capable of promoting plant growth and application of the enteric bacilli, and aims at solving the problem of heavy metal cadmium pollution and the problem that plants are difficult to grow in cadmium-polluted soil. The Latin name of the enteric bacilli is eterobacter sp; the preservation unit is the China General Microbiological Culture Collection Center; the preservation date is August 25, 2014; and the preservation number is CGMCC No.9539. Cadmium in a water-polluted environment can be gathered by the adsorption effect of a bacterial strain on the cadmium, so as to be removed; and the target of purifying a water body is achieved. Meanwhile, the bacterial strain is capable of adsorbing and fixing the heavy metal cadmium in soil, and reducing the content of effective cadmium in soil. In addition, the bacterial strain has the effect of synthesizing and secreting auxin IAA, is capable of accelerating rapid growth of plants, and has wide application prospect in practical production.
Owner:SICHUAN LANYUE SCI & TECH +1

Colon bacillus outer membrane protein monoclonal antibody and preparation method and application thereof

The invention belongs to the technical field of veterinary biology, and particularly relates to a colon bacillus outer membrane protein monoclonal antibody and a preparation method and an application thereof. The antibody is prepared by taking cloned, expressed and purified taking avian pathogenic escherichia coli 78 (APECO78) outer membrane protein as an antigen immune BALB / c mouse with a hybrid tumor technology. The antibody has high specificity and high sensitivity, and an experimental basis is laid for future rapid and specific detection of colon bacillus infection with an immunology method. Meanwhile, as proved by an experiment, the monoclonal antibody disclosed by the invention has high neutralizing activity and protecting efficiency on colon bacillus infection of the same type, and can be used for preventing colibacillosis.
Owner:兆丰华生物科技(南京)有限公司 +1

Escherichia coli-bacillus subtilis shuttle expression vector and application thereof

ActiveCN102002509AStrong ability to secrete extracellular proteinsFungiBacteriaAspergillus nidulansGenetic engineering
The invention discloses an Escherichia coli-bacillus subtilis shuttle expression vector and application thereof, and belongs to the field of genetic engineering. The Escherichia coli-bacillus subtilis shuttle expression vector comprises a bacillus subtilis promoter sequence, a bacillus subtilis signal peptide coding sequence, an artificially designed ribosome binding sequence which can be identified by bacillus subtilis, the artificially designed enzyme cutting site of bacillus subtilis signal peptidase, an artificially designed multiple cloning site, a bacteriophage terminator sequence, a bacillus subtilis replicating initial sequence, and an Escherichia coli replicating initial sequence. The vector can be replicated in Escherichia coli and can also be replicated and expressed in the bacillus subtilis, so that vectors for a bacillus subtilis expression system are enriched; and the vector uses a B.subtilis deacetylated chitinase signal peptide for the first time, the signal peptide has high capability of guiding to secrete extracellular protein, a reporter gene is aspergillus nidulans pectate lyase gene, and the extracellular expression level reaches 600U / mL which is higher than that when the pectate lyase gene uses other vectors.
Owner:JIANGNAN UNIV

Gene of internal cutting glucanase of Bacillus megatherium and preparation process thereof

InactiveCN1597927AGrowth inhibitionAchieve biological control effectBacteriaFermentationEscherichia coliGlucanase
The invention is a gene of huge bacillus endoglucanase and its preparing method. The invention uses SDS, proteinase K and CTAB / NaCl processes to extract DNA from huge bacillus genome, uses Sau3A to make partial enzyme cutting, connects gene fragment with linearized plasmid pBluescriptII, converts Escherichia coli DH5alpha, screens electropositive clonal seeds (74 strains) by endoglucanase enzyme activity detection, extracts the recombinant plasmids from the invert seeds with better enzyme activity expression, and obtains endoglucanase coded gene fragments amounting to 941bp. The gene fragment can dehydrate beta- bond at will along the amylase chain to release oligose, degrading the cell walls of pathogenic epiphyte, inhibiting the epiphyte growth and achieving the preventing and controlling effect.
Owner:BIOLOGY INST OF SHANDONG ACAD OF SCI

Bacillus megaterium ALA2 cytochrome P450 enzyme gene and methods of recombinant plasmid construction and enzyme purification

The product relates to Bacillus megaterium ALA2 cytochrome P450 enzyme gene and methods of recombinant plasmid construction and enzyme purification and the nucleotide sequence cypI of the gene is mentioned in SEQIDNO.1. Through escherichia coli expression carrier selection and gene directed modification, the expression level of recombinant protein substantially is increased by a selected pTrc99A carrier and is 3.8 times higher than the expression level of recombinant protein with a selected pET20b carrier, and the enzyme activity reaches 700U / mL. The modified coding Bacillus megaterium ALA2 cytochromes P450 enzyme gene cypI is inserted in pYrc99A and transformed into escherichia coli. Then the enzyme activity expressed in escherichia coli raises 32% in comparison with that of original gene cyp and reaches 1020U / mL (figure-2).
Owner:NANJING FORESTRY UNIV

Multi-effect bacillus subtilis for high yield of immune polysaccharide and bacteriocin and application

The invention provides multi-effect bacillus subtilis for high yield of immune polysaccharide and bacteriocin and application. The preservation number of the bacillus subtilis provided by the invention is CGMCC NO.20463. The strain has excellent extracellular immune polysaccharide production capability; after fermentation by a conventional method, fermentation liquor is purified, and the yield ofthe exopolysaccharide is as high as 8203.64 mg / L; and the strain has excellent bacteriocin production capacity and endotoxin digestion capacity, and can effectively inhibit pathogenic or harmful bacteria such as salmonella, escherichia coli, staphylococcus aureus, listeria monocytogenes, sarcina lutea, streptococcus, clostridium perfringens and the like. The bacillus subtilis disclosed by the invention can be used as a food additive or a feed additive, has good immunoregulation, antibacterial, antiviral, anti-inflammatory and antioxidant capacities, and has a wide application prospect in the aspects of disease resistance, disease prevention and livestock and poultry antibiotic substitution.
Owner:CHINA AGRI UNIV

Gene engineering bacterium for producing keratinase escherichia coli and application thereof

The invention discloses a gene engineering bacterium for producing keratinase escherichia coli and an application thereof, and belongs to the technical field of the gene engineering. The keratinase (ker) gene of bacillus licheniformis (Bacillus licheniformis BBE11-1) is connected to an escherichia coli expression vector pET22b(+) by the recombination DNA (deoxyribonucleic acid) technology; Escherichia coli BL21(DE3) is converted; one plant of combination escherichia coli BL21(Escherichia coli DE3)-pET22b(+)-ker capable of generating higher keratinase is obtained by screening and identifying; and the collection number is CCTCC (China center for type culture collection) No: M 2012180. The enzyme activity of the keratinase expressed by the bacterial strain is 256U / mL, and a good foundation is laid for the large-scale production of the keratinase.
Owner:JIANGNAN UNIV

Recombinant escherichia coli for heterologously synthesizing ambrein and construction method thereof

The invention discloses recombinant escherichia coli for heterologously synthesizing ambrein and a construction method thereof. The construction method comprises the following steps of: (1) fusing saccharomyces-cerevisiae squalene synthase gene ERG9 with truncation of 26 amino acid residues at a C end and homologous arms at the upstream and downstream of a lacZ site of the escherichia coli into adonor DNA; constructing plasmid 1; transforming the donor DNA and the plasmid 1 together into the escherichia coli, eliminating the plasmid 1, obtaining the recombinant escherichia coli for synthesizing squalene, and naming the recombinant escherichia coli as a strain 1; (2) connecting alicyclobacillus-acidocardarius squalene-hopene cyclase gene D377C SHC with mutation from the 377th amino acid residue into cysteine residue and bacillus-megaterium cyclase gene BmeTC into one segment, then inserting the segment into escherichia-coli expression plasmid p5C to obtain plasmid 4; (3) transforming the plasmid 4 into the strain 1 to obtain the recombinant escherichia coli for heterologously synthesizing the ambrein, and naming the recombinant escherichia coli as a strain 4. Proved by experiments,the recombinant escherichia coli for heterologously synthesizing the ambrein is fermented to obtain the ambrein.
Owner:TIANJIN UNIV

Constant temperature nucleic acid amplification fast detecting reagent kit for bacillus coli O157 and use method thereof

The invention discloses an escherichia coli O157 mediated isothermal nucleic acid amplification rapid detecting kit and a use method thereof. The kit comprises a primer mixed liquor, which adopts the sequence: an outer primer 1: GCTATACCACGTTACAGCGTG, an outer primer 2: ACTACTC AACCTTCCCCAGTTC, an inner primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTC TTATCTGG, an inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC, a phosphate buffer solution PBS, paraformaldehyde, polylysine, lysozyme, proteinase K, RNase, BstDNA polymerase, a reaction solution, a sample pretreatment solution, a chromogenic agent, positive control and negative control. Highly specific, rapid, efficient and sensitive and simple situ detection for escherichia coli O157 can be realized through the escherichia coli O157 immobilized processing, cell permeability processing, mediated isothermal amplification for genes, and determining the results of the reaction products by using the kit.
Owner:SOUTH CHINA UNIV OF TECH

Synthesis method and applications of urea peroxide

The invention discloses a synthesis method of urea peroxide and applications of the urea peroxide in an antibacterial agent. The synthesis method comprises the following steps: adding hydrogen peroxide and urea into a reactor in proportion, and stirring at room temperature to dissolve hydrogen peroxide and urea; adding an additive into the reactor, and stirring at room temperature; and cooling andcrystallizing an solution in the reactor, filtering, and freeze-drying an obtained filter cake. The urea peroxide obtained by the invention is solid powder, is not easy to absorb moisture, is convenient to store and transport, is not easy to deteriorate, has a good sterilization effect, has good inhibition and killing effects on staphylococcus aureus, escherichia coli, bacillus sakazakii, salmonella typhimurium, listeria monocytogenes and vibrio parahaemolyticus, and is a potential broad-spectrum antibacterial agent.
Owner:UNIV OF SHANGHAI FOR SCI & TECH

Bionectria ochroleuca Bo-1 strain, cultures thereof, and applications of the strain and the cultures thereof in resisting pathogenic bacteria

The present invention relates a plant endophyte Bionectria ochroleuca Bo-1 strain, cultures thereof, and applications of the strain and the cultures thereof in resisting pathogenic bacteria. The strain is preserved in China Center for Type Culture Collection (CCTCC), the address of the center is Wuhan University, Wuhan, China, the accession number is CCTCCNO: M2013027, and the preservation date is January 18, 2013. The Bionectria ochroleuca Bo-1 strain of the invention has high resisting performance for Xanthomonas campestris pv.oryzae, and a strong inhibitory effect on Monilia albicans (M.albican), Escherichia coli (E. coli), Staphylococcus aureus (S. aureus ), Bacillus subtilis (B. subtilis) and other pathogenic bacteria.
Owner:郎溪品旭科技发展有限公司

Plant volatile oil having broad spectrum antibiotic activity, its prepn. method and usage

A vegetative volatile oil with broad-spectrum antibacterial activity to Staphylococcus aureus, colibacillus, Bacillus subtitis, etc is prepared from the stem, leaf, flower and fruit of Canadian goldenrod herb. Its 4 active components, it optimal picking-up reason and its preparing process are also disclosed.
Owner:FUDAN UNIV

Water-soluble photostable silver (I) complex and preparation method and application thereof

The invention relates to transition metal coordination polymer, in particular to a water-soluble photostable silver (I) complex with a bacteriostatic effect and a preparation method thereof. A chemical formula of the complex is [Ag8(L)2(DMF)2]infinite, wherein L is a 3,4,5,6-tetrafluorophthalatedicarboxyl anionic ligand, and DMF is N,N-dimethylformamide. The complex is synthesized in methanol and DMF solution by a solvent volatilization method by taking silver nitrate and 3,4,5,6-tetrafluorophthalic acid as reaction raw materials. The synthesis method is mild in conditions, high in yield and repeatability, and is convenient to operate. A complex crystal sample has high bacteriostatic activity to staphylococcus aureus, Escherichia coli and bacillus subtilis, high water solubility and photostability, is convenient to store and transport, and can be applied to the fields of medical treatment and life science; and the minimal inhibitory concentration is in the range of 0.5 to 2mu g / mL.
Owner:溧阳常大技术转移中心有限公司

Abortus Chlamydia psittaci vaccine and preparation method thereof

The invention relates to a bovine abortus Chlamydia psittaci subunit vaccine and a preparation method thereof. The vaccine is the subunit vaccine formed by Chlamydophila abortus outer membrane protein A (OmpA), and the preparation method of the vaccine comprises the steps of extracting bacterial total DNA to be served as a template from the Chlamydophila abortus, designing two pairs of specific primers and conducting nested polymerase chain reaction and amplification to obtain the complete gene of the Chlamydophila abortus outer membrane protein A (OmpA), and cloning the gene to a prokaryotic expression vector to obtain a recombinant expression vector; using the recombinant expression vector to transform colon bacillus competent cells, extracting recombinant plasmid and screening out positive clone by PCR and enzyme cutting identification; and transferring the recombinant plasmid into the colon bacillus and conducting induction expression to obtain the antigen protein used for the vaccine.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Hylarana guentheri antibacterial peptide and application thereof

The invention relates to sequences, a preparation method and application of two types of hylarana guentheri antibacterial peptides. The two types of antibacterial peptides are separated from skin secreta of hylarana guentheri, and antibacterial and hemolytic activities of the antibacterial peptides are detected; a secondary structure of the antibacterial peptides under a simulated film environment is researched. The two antibacterial peptides are obtained: the antibacterial peptide A with an amino acid sequence shown as SEQ ID NO.1; the antibacterial peptide B with an amino acid sequence shown as SEQ ID NO.2. The antibacterial peptide A provided by the invention has an inhibition effect on staphylococcus aureus, colon bacillus and bacillus subtilis; the antibacterial peptide B has a very good sterilization effect on the bacillus subtilis and the staphylococcus aureus. The two types of antibacterial peptides, provided by the invention, have the characteristics of novel structure, strong antibacterial activities and the like, and have an important value in the aspects of medicine development and application. The sequences, the preparation method and the application of two types of the hylarana guentheri antibacterial peptides have important meanings on researches of an antibacterial mechanism of the antibacterial peptides, and further improvement, and development and utilization of the antibacterial peptides.
Owner:FUZHOU UNIV

Bacillus velezensis strain wr8 and application thereof

ActiveCN113862194ABroad antibacterial effectBroad disease resistanceBiocideFruit and vegetables preservationBiotechnologyEscherichia coli
The invention relates to the technical field of microorganisms, in particular to a bacillus velezensis strain wr8 and application thereof. The bacillus velezensis wr8, fungicide and metabolite have the wide antibacterial and disease-resistant effects, and have the inhibiting effect on penicillium, penicillium, botrytis cinerea, escherichia coli, listeria monocytogenes and other germs, and in the direct application, the strain can be used for preventing and treating southern blight and root rot of siraitia grosvenorii, and can be used for preventing and treating banana fusarium wilt, orange mycosis, citrus reiculata mycosis and the like; the bacillus velezensis strain wr8 can be applied to fruit preservation of the plants, and the application range of the bacterial fertilizer biocontrol field is quite wide; and meanwhile, the strain can inhibit escherichia coli and listeria monocytogenes, can also be applied to the field of food preservation, has multiple functions and wide application fields, and has good prospects in the fields of later food processing, fruit and vegetable preservation, biological control and biological bacterial fertilizers.
Owner:GUANGXI ACAD OF SCI

Preparation method for traditional Chinese medicine hand washing solution having sterilization function

InactiveCN103006483ANot corrosiveSterilization function is satisfiedBiocideCosmetic preparationsEscherichia coliLiquid laundry detergent
The present invention relates to a preparation method for a traditional Chinese medicine hand washing solution having a sterilization function, especially having a bacillus enteritidis and escherichia coli killing function. According to the present invention, airpotato yam rhizome, cultivated purple perilla leaf, Chinese magnoliavine fruit, gleditsia sinensis lam, angelica, creeping liriope and angelica archang lica are decocted into a juice, the obtained juice is compounded with an ordinary liquid laundry detergent, and the obtained traditional Chinese medicine hand washing solution has effects of ordinary hand washing solutions and a sterilization function.
Owner:邓丽

Bacillus subtilis, its combination preparation and method for preparing combination preparation

The invention relates to a bacilli, its compound preparation and the preparing method for the compound preparation. Its name is Bacillus subtilis LY-35, which is preserved in the general microbe center of Micro Germ conservation Management committee of China, and its conservation number is:CGMCC N0.1222. The preparation is a mixture of lambda phage of culture of bacilli and staphylococcus, streptococcus, colibacillus, bacillus proteus, pseudomonad, salmonella, pasteurella and klebsiella, can cure and prevent all kinds of illness caused by conditional pathogen,is a micro biological preparation which can be used by being mixed with antibiotics or replace antibiotics without any remainder and pollution, with good curative effect and safety.
Owner:烟台绿云生物工程研究院有限公司

Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof

The invention relates to a bifidobacterium-escherichia coli shuttle expression vector, the preparation method and the usage, which pertains to the field of genetic engineering. The technical problem to be solved by the invention is to provide a new high-efficient and safe bifidobacterium-escherichia coli shuttle expression vector which has the stable expression. The bifidobacterium-escherichia coli shuttle expression vector of the invention takes a pGEX-5x-1 plasmid as a skeleton, a promoter Ptac on the pGEX-5x-1 is replaced by the promoter AmyO of an Alpha-amylase gene of the bifidobacterium, and the invention further contains the replication protein B sequence of a KJ36 plasmid of bifidobacterium longum. The bifidobacterium-escherichia coli shuttle expression vector of the invention canbe widely applicable to the expression of all foreign genes which take the bifidobacterium as the receptor bacteria and the production of genetic engineering products, thereby providing a new vector toll for the related application of the field and having great application prospect.
Owner:北京爱施凯健康管理发展有限公司

Screening model and application of gram negative bacterium resistant medicament using SecA power pump as target spot

The invention relates to a thermosensitive recombinant colon bacillus for efficiently expressing the secA deletion of secA genes of gram negative bacteria such as Pseudomonas aeruginosa, in particularto a novel microbial cell level screening model of a gram negative bacterium resistant medicament using a SecA power pump as a target spot. The screening model utilizes the thermosensitive recombinant colon bacillus efficiently expressing the secA deletion of the secA genes of the Pseudomonas aeruginosa, wild type colon bacilli and the Pseudomonas aeruginosa to carry out microbial cell level gramnegative bacterium resistant medicament screening on a secondary metabolite of a candidate microorganism aiming at the SecA power pump target spot. The screening model can be also used for screeningaiming at a candidate compound.
Owner:MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI

Compound bactericide with broad-spectrum bactericidal effect

The invention provides a compound bactericide with bacteriostatic or bactericidal activity. The composition comprises, by weight, 40% to 50% of linalool, 18% to 25% of terpilenol, 8% to 15% of geraniol, 2% to 4% of beta-cyclocitral, 2.5% to 5% of nerol, 1% to 3% of myrcene, 1% to 3% of ocimene, 3% to 6% of ionone and 5% to 8% of 2H-beta-ionone. Antibacterial and bacteriostatic drug sensitivity tests show that the bactericide artificially prepared on the basis of natural essential oil components has a broad-spectrum inhibition effect on bacteria and fungi. The bactericide has bacteriostatic andbactericidal effects on bacteria (escherichia coli, bacillus subtilis, staphylococcus aureus, staphylococcus epidermidis and the like) and fungi (candida albicans, Schlechospora crassa, trichophytonrubrum, saccharomyces cerevisiae and the like), and particularly has an obvious effect on zoonosis. The bactericide can be applied to development of zoonosis infection and other sterilization products.
Owner:NORTHEAST NORMAL UNIVERSITY

Chinese medicinal formulation for removing dampness to velieve itching

The present invention provides a dampness-eliminating itching-relieving Chinese medicine preparation with the action of inhibiting dermatomyces, trichophyton violaceum, trichophyton concentricum, achorion schoenleini and bacteria of staphylococcus aureus, hemolytic streptococcus, colibacillus, bacillus pyocyaneus and bacillus proteus, etc. for curing dermatosises with obvious therapeutic effect. Said Chinese medicine preparation is made up by using 10 Chinese medicinal materials of kochia fruit, cnidium seed, silkworm, dictamnus root bark, capillaries, schizonepeta spike and others through a certain preparation process.
Owner:李伟

Bacillus velezensis and application thereof

The invention discloses bacillus velezensis and application thereof. The formula comprises bacillus velezensis, the mass percent of the components is as follows: 100% of bacillus velezensis. The bacillus velezensis has the capacity of producing cellulase, amylase, protease, beta-glucanase and hydrogen peroxide. The bacillus subtilis has a good antagonistic effect on food-borne pathogenic bacteria and plant pathogenic bacteria such as staphylococcus aureus, escherichia coli, sclerotium rolfsii, alternaria alternata, ralstonia solanacearum, agrobacterium tumefaciens, Erwinia carotovora, penicillium citrinum and downy mildew, and breeding of the pathogenic bacteria is effectively inhibited; the invention has wide application in the aspects of plant growth promotion, disease prevention and control, environmental protection, food production and the like; through two antagonistic screening, the screening strength in the preparation process is improved, the antagonistic activity of a cultured product is enhanced, breeding of pathogenic bacteria is effectively inhibited, and the quality of bacillus velezensis is improved.
Owner:毕节市家乡美农业综合开发有限公司

Method for screening corynebacterium crenatum endogenous high-expression promoter by using 2-DE (Two-Dimensional Electrophoresis) technique

The invention discloses a method for screening a corynebacterium crenatum endogenous high-expression promoter by using a 2-DE (Two-Dimensional Electrophoresis) technique, which belongs to the fields of proteomics and gene engineering. The method comprises the following steps of: identifying a high-expression protein point in a corynebacterium crenatum mycetocyte through the 2-DE technique in combination with a mass-spectrometric technique; and cloning encoding gene promoters, naming as P-argC, P-argG, P-argF, P-ilvC and P-serA respectively, replacing a tac promoter on a shuttle vector pDXW-8, inserting a cat gene downstream, transforming colon bacillus JM109 and corynebacterium crenatum SYPA5-5 respectively, and measuring the activity of CAT (Catalase), wherein the activities of the prompters P-argG, P-argF, P-ilvC, P-serA and P-argC in a recombinant strain decrease in sequence. According to the method, a constitutive high-expression promoter from corynebacterium crenatum is obtained for the first time, and an effective tool is provided for a corynebacterium crenatum high-expression exogenous gene.
Owner:JIANGNAN UNIV

Novel bacillus X901 strain with relatively strong bacteriostatic action and application thereof

The invention discloses a novel bacillus strain X901 with a relatively strong bacteriostatic action and an application thereof. The preservation number of the strain is GDMCC No: 61472. The bacillus X901 strain is a new bacillus strain which is separated and identified for the first time in China and has bacteriostatic activity, and bacteriostatic substances can be generated in the whole culture process. The crude antibacterial product and the extracellular polysaccharide extract have a relatively obvious antibacterial effect on gram-negative bacteria (escherichia coli, haemophilus parasuis and aeromonas veronii) and gram-positive bacteria (staphylococcus aureus, streptococcus suis and bacillus subtilis). The strain has no drug resistance or drug resistance, has no pathogenicity when being orally taken, and is safe. In the breeding production of livestock and poultry, aquatic products and other animals, the strain can be used as a probiotic strain or a feed microbial additive, the use of antibiotics is reduced, the disease resistance of animals is improved, and the strain has very high application value.
Owner:FOSHAN NANHAI EASTERN ALONG PHARMA CO LTD