94 results about "Bacillus enteritidis" patented technology

The invention relates to a microbial detection device and a detection method of meat of livestock and poultry. The salmonella and Escherichia coli O157 multiple PCR rapid detection kit of the meat of livestock and poultry includes: 10 multiplied by PCR buffer, 1.0 to 3.0mmol / L of MgCl2, 240 Mumol / L of dNTP each, 200nmol / L of salmonella primer, 200nmol / L of Escherichia coli O157 primer and 1.3 to 3.0U of Taq enzyme. The microbial detection device has better specificity, which can complete the simultaneous detection of the salmonella and the Escherichia coli O157 within 8 to 9h; compared with the conventional bacteriology, the diagnosis is rapid, convenient and economical, thus providing a powerful technical means for the diagnosis of pathogen in a food sample and having good application prospect.

The invention discloses enteric bacilli with a fixing effect on cadmium capable of promoting plant growth and application of the enteric bacilli, and aims at solving the problem of heavy metal cadmium pollution and the problem that plants are difficult to grow in cadmium-polluted soil. The Latin name of the enteric bacilli is eterobacter sp; the preservation unit is the China General Microbiological Culture Collection Center; the preservation date is August 25, 2014; and the preservation number is CGMCC No.9539. Cadmium in a water-polluted environment can be gathered by the adsorption effect of a bacterial strain on the cadmium, so as to be removed; and the target of purifying a water body is achieved. Meanwhile, the bacterial strain is capable of adsorbing and fixing the heavy metal cadmium in soil, and reducing the content of effective cadmium in soil. In addition, the bacterial strain has the effect of synthesizing and secreting auxin IAA, is capable of accelerating rapid growth of plants, and has wide application prospect in practical production.

The product relates to Bacillus megaterium ALA2 cytochrome P450 enzyme gene and methods of recombinant plasmid construction and enzyme purification and the nucleotide sequence cypI of the gene is mentioned in SEQIDNO.1. Through escherichia coli expression carrier selection and gene directed modification, the expression level of recombinant protein substantially is increased by a selected pTrc99A carrier and is 3.8 times higher than the expression level of recombinant protein with a selected pET20b carrier, and the enzyme activity reaches 700U / mL. The modified coding Bacillus megaterium ALA2 cytochromes P450 enzyme gene cypI is inserted in pYrc99A and transformed into escherichia coli. Then the enzyme activity expressed in escherichia coli raises 32% in comparison with that of original gene cyp and reaches 1020U / mL (figure-2).

The invention discloses an escherichia coli O157 mediated isothermal nucleic acid amplification rapid detecting kit and a use method thereof. The kit comprises a primer mixed liquor, which adopts the sequence: an outer primer 1: GCTATACCACGTTACAGCGTG, an outer primer 2: ACTACTC AACCTTCCCCAGTTC, an inner primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTC TTATCTGG, an inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC, a phosphate buffer solution PBS, paraformaldehyde, polylysine, lysozyme, proteinase K, RNase, BstDNA polymerase, a reaction solution, a sample pretreatment solution, a chromogenic agent, positive control and negative control. Highly specific, rapid, efficient and sensitive and simple situ detection for escherichia coli O157 can be realized through the escherichia coli O157 immobilized processing, cell permeability processing, mediated isothermal amplification for genes, and determining the results of the reaction products by using the kit.

A vegetative volatile oil with broad-spectrum antibacterial activity to Staphylococcus aureus, colibacillus, Bacillus subtitis, etc is prepared from the stem, leaf, flower and fruit of Canadian goldenrod herb. Its 4 active components, it optimal picking-up reason and its preparing process are also disclosed.

The invention relates to transition metal coordination polymer, in particular to a water-soluble photostable silver (I) complex with a bacteriostatic effect and a preparation method thereof. A chemical formula of the complex is [Ag8(L)2(DMF)2]infinite, wherein L is a 3,4,5,6-tetrafluorophthalatedicarboxyl anionic ligand, and DMF is N,N-dimethylformamide. The complex is synthesized in methanol and DMF solution by a solvent volatilization method by taking silver nitrate and 3,4,5,6-tetrafluorophthalic acid as reaction raw materials. The synthesis method is mild in conditions, high in yield and repeatability, and is convenient to operate. A complex crystal sample has high bacteriostatic activity to staphylococcus aureus, Escherichia coli and bacillus subtilis, high water solubility and photostability, is convenient to store and transport, and can be applied to the fields of medical treatment and life science; and the minimal inhibitory concentration is in the range of 0.5 to 2mu g / mL.

The invention relates to sequences, a preparation method and application of two types of hylarana guentheri antibacterial peptides. The two types of antibacterial peptides are separated from skin secreta of hylarana guentheri, and antibacterial and hemolytic activities of the antibacterial peptides are detected; a secondary structure of the antibacterial peptides under a simulated film environment is researched. The two antibacterial peptides are obtained: the antibacterial peptide A with an amino acid sequence shown as SEQ ID NO.1; the antibacterial peptide B with an amino acid sequence shown as SEQ ID NO.2. The antibacterial peptide A provided by the invention has an inhibition effect on staphylococcus aureus, colon bacillus and bacillus subtilis; the antibacterial peptide B has a very good sterilization effect on the bacillus subtilis and the staphylococcus aureus. The two types of antibacterial peptides, provided by the invention, have the characteristics of novel structure, strong antibacterial activities and the like, and have an important value in the aspects of medicine development and application. The sequences, the preparation method and the application of two types of the hylarana guentheri antibacterial peptides have important meanings on researches of an antibacterial mechanism of the antibacterial peptides, and further improvement, and development and utilization of the antibacterial peptides.

The invention discloses a novel bacillus strain X901 with a relatively strong bacteriostatic action and an application thereof. The preservation number of the strain is GDMCC No: 61472. The bacillus X901 strain is a new bacillus strain which is separated and identified for the first time in China and has bacteriostatic activity, and bacteriostatic substances can be generated in the whole culture process. The crude antibacterial product and the extracellular polysaccharide extract have a relatively obvious antibacterial effect on gram-negative bacteria (escherichia coli, haemophilus parasuis and aeromonas veronii) and gram-positive bacteria (staphylococcus aureus, streptococcus suis and bacillus subtilis). The strain has no drug resistance or drug resistance, has no pathogenicity when being orally taken, and is safe. In the breeding production of livestock and poultry, aquatic products and other animals, the strain can be used as a probiotic strain or a feed microbial additive, the use of antibiotics is reduced, the disease resistance of animals is improved, and the strain has very high application value.

The invention relates to a preparation method and antioxidation and bacteriostatic actions of an ethanol extract from ginger. The preparation method is characterized in that the ginger and a ginger product are taken as raw materials and extracted by 60-99% of ethanol, ethanol is recycled, and the extract or dry powder is prepared. The ethanol extract from the ginger contains more gingerol. The experiment proves that the ethanol extract from the ginger has obvious antioxidation and peroxy radical clearing actions and also has obvious bacteriostatic action on staphylococcus aureus, colibacillus, pseudomonas aeruginosa and bacillus subtilis. The ethanol extract from the ginger is a natural antioxidative and antibacterial substance and has a certain application prospect in safe, effective and harmfulless natural food additives.