Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

74 results about "Ammonia n" patented technology

Ammonia is a nutrient that contains nitrogen and hydrogen. Its chemical formula is NH. 3 in the un-ionized state and NH. 4 + in the ionized form.

Immobilized adsorption microspheres and application thereof in treatment of glutamic acid high ammonia nitrogen fermentation wastewater

The invention belongs to the technical field of environmental protection of bioremediation wastewater, and discloses an immobilized adsorption microsphere, which is prepared from Bacillus spp., Candida utilis and European nitrosomonas through an immobilized embedding technology. The microspheres provided by the invention can effectively repair glutamic acid high ammonia nitrogen fermentation wastewater.
Owner:BAOJI FUFENG BIOTECH

A method for efficient denitrification and decarburization of biogas slurry from co-fermentation of kitchen waste and sludge

The application discloses a method for efficient denitrification and decarburization of kitchen waste and sludge co-fermentation anaerobic digestion effluent, which removes part of COD and ammonia nitrogen in the influent sludge by using a first SNAD, and maintains a certain amount of free ammonia of a certain concentration due to the high concentration of ammonia nitrogen and the high pH of the influent, so as to maintain the inhibition effect on nitrifying bacteria and ensure the conversion of part of the ammonia nitrogen into nitrite nitrogen, and the high activity of anaerobic ammonia oxidation bacteria is ensured in the first SNAD by limiting the aeration amount, so that the ammonia nitrogen and nitrite can be further removed; the effluent enters a nitrification tank, and the ammonia nitrogen is nitrified into nitrate nitrogen under the condition of nitrifying bacteria and sufficient aeration amount, and then enters a denitrification tank, and the denitrification process is carried out under the condition of heterotrophic denitrifying bacteria and sufficient carbon source, so that most of the nitrate nitrogen in the system is converted into nitrogen gas and removed, finally, the clear liquid is discharged after being filtered by an MBR membrane in a membrane tank, so as to achieve the purpose of efficient denitrification and decarburization of kitchen waste anaerobic digestion effluent.
Owner:DALIAN UNIV OF TECH +1

Molecular marker and primer pair related to high ammonia nitrogen stress resistance of litopenaeus vannamei and application of molecular marker and primer pair

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.
Owner:GUANGDONG OCEAN UNIVERSITY

Efficient heterotrophic nitrification-aerobic denitrification bacterium with flocculation function and application of efficient heterotrophic nitrification-aerobic denitrification bacterium in kitchen wastewater treatment

The invention relates to the technical field of environmental microbial resource development and sewage denitrification. The invention discloses an efficient denitrification strain Paracoccus sp.N21 with a flocculation characteristic, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.34710. The invention further discloses a preparation method of the efficient denitrification strain Paracoccus sp.N21. The strain obtained by the invention can completely remove ammonia nitrogen within 12 hours and thoroughly remove nitrate nitrogen within 48 hours, the removal rate reaches 100%, and ammonia nitrogen is preferentially degraded in a mixed nitrogen source. The method has the unique advantages that the flocculation rate in the nitrification process and the flocculation rate in the denitrification process exceed 93.9%, and the usage amount of a flocculating agent can be greatly reduced. When actual kitchen wastewater is treated, the ammonia nitrogen removal rate reaches 100%, and the removal rate reaches up to 7.51 mg / (L.h). The application of the strain can effectively reduce the volume of a reactor, reduce energy consumption and operation cost, provides a new solution for simplifying a biological denitrification process, is particularly suitable for treating high-ammonia-nitrogen kitchen wastewater, and has remarkable environmental and economic benefits.
Owner:LUKONG ENVIRONMENTAL PROTECTION TECHNOLOGY CO LTD +1

Production method of low-salt high-ammonia-nitrogen cost-reducing soy sauce

The invention discloses a production method of low-salt high-ammonia-nitrogen cost-reducing soy sauce, and relates to the technical field of seasonings. The production method comprises the following steps: mixing salt water into finished koji after a koji making stage, discharging the koji, preparing mash, adding cured and crushed soybeans in the process, and carrying out heat preservation and fermentation. According to the method, residual enzyme active resources in the existing starter propagation process are utilized, and a proper amount of cured soybeans are added in the fermentation process for secondary utilization. Substrate adaptation and technological parameters are cooperatively regulated and controlled, so that surplus enzyme activity is fully utilized, meanwhile, the inner surface area of the cured soybeans is increased, decomposition and utilization of enzymes and microorganisms are facilitated, and the enzyme-substrate contact efficiency is remarkably improved. The fermentation temperature, the fermentation duration and the concentration of saline water are optimized, the utilization rate of enzyme activity is maximized, macromolecules such as protein are converted more efficiently, the fermentation cost is remarkably reduced, and the fermentation period is shortened. The salt content of the produced soy sauce is 8.92 g / 100 mL, the amino acid nitrogen content is 1.374 g / 100 mL, the total nitrogen content is 2.223 g / 100 mL, and a solution is provided for production of the low-salt high-freshness soy sauce.
Owner:LEE KUM KEE XIN HUI FOOD

Method for producing biogas by anaerobic fermentation of pea protein wastewater

PendingCN122627611AAmmonia toxicitySulfate radicals
The application provides a method for producing biogas by anaerobic fermentation of pea protein wastewater, and relates to the technical field of biomass energy utilization, wherein the chemical oxygen demand is 10000-15000 mg / L, the ammonia nitrogen is 400-800 mg / L, and the sulfate radical is 600-1000 mg / L; the method comprises the following steps: (1) gradient micro-oxygen hydrolysis acidification pretreatment; (2) physical-chemical and biochemical synergistic intensified pretreatment; and (3) anaerobic methane production. The method for producing biogas by anaerobic fermentation of pea protein wastewater is capable of effectively inhibiting sulfate reducing bacteria, reducing hydrogen sulfide generation, reducing free ammonia toxicity and accelerating hydrolysis of macromolecular organic matter through gradient micro-oxygen hydrolysis acidification. In combination with modified tourmaline ceramic and magnetization synergistic treatment, the microbial activity and mass transfer efficiency are further improved. The whole process can be stably operated, the COD removal rate, the biogas yield and the methane content are significantly improved, and the harmless treatment of the pea protein wastewater and the resource utilization of the biogas are efficiently realized.
Owner:SHANDONG FURUN BIOTECHNOLOGY CO LTD

Method for continuously fermenting urine to produce safe fertilizer

The application discloses a method for continuously fermenting urine to produce safe fertilizer, which comprises the following steps: in the first fermentation, adding environment-friendly enzyme into a container, then collecting fresh urine and adding molasses, and carrying out fermentation in a sealed manner; after the fermentation is completed, reserving part of the fermentation liquor as a substrate; and in the subsequent batches, directly adding fresh urine and molasses into the container with the substrate to carry out fermentation, so as to realize continuous circulation. The method can inhibit the hydrolysis process of urea in the urine in the early stage by timely adding environment-friendly enzyme (or the fermentation liquor of the last time) and molasses into the fresh urine to carry out fermentation, thereby greatly reducing the ammonia nitrogen volatilization amount, and the pathogenic bacteria in the urine can be inhibited to a very low level in a short period of time. Except that the environment-friendly enzyme needs to be added in the first fermentation, the environment-friendly enzyme does not need to be added in the subsequent batches of fermentation, and only a small amount of molasses needs to be added. A large amount of beneficial bacteria such as lactic acid bacteria and yeast and metabolic products such as lactic acid and acetic acid are generated in the fermentation process, so that the urine is converted into microbial bacterial fertilizer.
Owner:DEQING COUNTY ZHEJIANG UNIV OF TECH MOGANSHAN RES INST

Application of bacillus megaterium in preparation of fermented feed for reducing methane emission of mutton sheep

The invention belongs to the field of animal feeding, and particularly relates to application of bacillus megatherium in preparation of fermented feed for reducing methane emission of mutton sheep, the bacillus megatherium is preserved in the China General Microbiological Culture Collection Center on December 6, 2004, and the preservation number is GMCCNo.1259. The invention also provides a fermented feed for reducing methane emission of mutton sheep, the degradation rate of straw rumen dry matter and crude protein can be remarkably increased, the ammonia nitrogen content in the feed is remarkably reduced, and the lactic acid bacteria content is remarkably increased.
Owner:YANGZHOU UNIV

Nitrogen source feeding control method in tylosin fermentation process

The invention discloses a nitrogen source feeding control method in a tylosin fermentation process, and belongs to the technical field of tylosin fermentation. A nitrogen source material supplementing control method in the tylosin fermentation process comprises two stages of dynamic material supplementing and comprises the following specific steps that in the early stage of fermentation, after a fermentation tank runs for 20 hours, continuous culture is conducted, the titer of tylosin in fermentation liquor is detected regularly, an ammonium nitrate solution starts to be supplemented, and the pH value of the fermentation liquor is stabilized between 6.55 and 6.80 through material supplementing. According to the nitrogen source feeding control method in the tylosin fermentation process, key parameters such as pH, dissolved oxygen, biomass and ammonia nitrogen concentration are collected in real time through cooperative work of the PLC system and the online sensor, the ammonium nitrate feeding rate is dynamically adjusted, nitrogen source supply is highly matched with thallus metabolism requirements, nitrogen source waste or insufficiency is avoided, and the production efficiency is improved. The nitrogen source utilization efficiency is improved; and a carbon source synchronous supplementing strategy is combined to stabilize a fermentation liquid environment, promote rapid growth of thalli and prolong a stable growth period.
Owner:QILU PHARMA INNER MONGOLIA

Anti-clogging granular ammonia-nitrogen removal agent automatic feeding and dosing device and feeding method thereof

The present application relates to the technical field of feeding and dosing device, especially relates to an automatic feeding and dosing device for anti-blocking granular ammonia-nitrogen removing agent and a feeding method thereof. The automatic feeding and dosing device and the feeding method thereof are aimed at solving the technical problems that the labor intensity of workers is large, dust is harmful to human body, the continuity and uniformity of dosing cannot be guaranteed, and the saving of reagent is not conducive in the prior art. The present application provides an automatic feeding and dosing device for anti-blocking granular ammonia-nitrogen removing agent, which comprises a supporting column, a material bin, a lifting control device, a guide assembly, an outer dust cover, a rotary control assembly, a sealing cover plate, a limiting seat, a screen, a flexible knocking assembly, a power device, a spraying pipe, a nozzle and a discharging adjusting assembly. The present application adopts a crane to automatically feed the ammonia-nitrogen removing agent, ensures the continuity and uniformity of dosing of the ammonia-nitrogen removing agent, saves the amount of the ammonia-nitrogen removing agent, effectively suppresses dust dispersion through spraying, and reduces the harm to human body.
Owner:江门市明星纸业有限公司

Method for extracting molybdenum through complexing and reverse extraction

The invention relates to a method for extracting molybdenum through complexation and reverse extraction, belongs to the field of non-ferrous metal hydrometallurgy, and solves the problems that ammonia nitrogen and sodium salt wastewater can be generated when molybdenum is extracted from an acid leaching solution through an extraction method in the prior art, and the environment is seriously polluted; the organic phase needs pickling regeneration, a large amount of acidic reagents are consumed, and the molybdenum extraction cost is increased; and the reverse extraction rate is low. The method comprises the following steps: extracting an acid leaching solution of molybdenum by using a cationic extractant at normal temperature, and separating after extraction to obtain a molybdenum-containing loaded organic phase and an acid raffinate; the molybdenum-containing loaded organic phase is subjected to back extraction with a back extraction agent containing oxalic acid, and an organic phase and molybdenum-enriched back extraction liquid are obtained through separation; and the reverse-extracted organic phase is used as an extracting agent to circularly extract molybdenum in the acid leaching solution. According to the method, the molybdenum-containing acidic leachate is extracted by using the cationic extractant at normal temperature, and the molybdenum-containing loaded organic phase is subjected to reverse extraction by using oxalic acid (or oxalic acid and hydrogen peroxide), so that the environment is optimized, and the reverse extraction rate of molybdenum is improved.
Owner:ZHONGYUAN CRITICAL METAL LAB

Fibricated fiber microbacteria and applications thereof

This invention discloses a fibrous microbacterium and its applications. The fibrous microbacterium, named IURM R23 and taxonomically named *Cellulosimicrobium cellulans*, was deposited on January 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 29729. The fibrous microbacterium provided by this invention exhibits highly efficient ammonia nitrogen degradation performance under high-salt conditions. The optimal degradation temperature for ammonia nitrogen by this fibrous microbacterium is 30–35°C, and the degradation effect is best under neutral pH conditions. The fibrous microbacterium provided by this invention tolerates low C / N ratios and has a wide tolerance range, thus possessing highly efficient nitrogen removal capabilities.
Owner:CHANGZHOU UNIV +2

A method for simultaneous nitrification and denitrification and chromium remediation of high ammonia-nitrogen wastewater based on a microorganism-promoter combination

The application discloses a high-ammonia-nitrogen wastewater simultaneous nitrification and denitrification and chromium remediation method based on a microorganism-promoter combination. 12 The combination is composed of simultaneous nitrification and denitrification bacteria and sodium azide (NaN3), alanine and dodecamolybdenum phosphate (PMo 12 ) and is used for detoxifying dissolved heavy metal chromium and improving denitrification efficiency. The method is to culture SND simultaneous short-cut nitrification and denitrification biological bacteria under aerobic conditions, inoculate the biological bacteria into a high-chromium solution, add biological promoters, promote the growth of microorganisms and the conversion of nitrogen, continuously receive and provide electrons in a reversible oxidation-reduction process, thereby reducing the total activation energy of the reaction and efficiently detoxifying heavy metal chromium. The microorganism-promoter combination technology obtained in this way can not only realize efficient simultaneous nitrification and denitrification in high-ammonia-nitrogen wastewater, but also maintain the biological activity of the SND bacteria in a high-chromium environment, thereby providing reliable technical support for efficient chromium removal and toxicity remediation of high-ammonia-nitrogen wastewater.
Owner:SOUTH CHINA UNIV OF TECH

A strain of Bacillus amyloliquefaciens that inhibits bacterial growth and reduces ammonia nitrogen and its application

This invention belongs to the field of biotechnology and discloses a strain of Bacillus amyloliquefaciens ZJ02 that inhibits bacterial growth and reduces ammonia nitrogen. Its accession number is CCTCC NO: M20252399, the accession date is October 30, 2025, and the depositary institution is the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China. ZJ02 exhibits significant antibacterial effects against Escherichia coli and Salmonella, with an inhibition zone size of 18.11 mm against Salmonella (SA) after 24 hours. Compared to other strains, it demonstrates superior ammonia nitrogen degradation under the same conditions, achieving a degradation rate of 76.58%, reaching as high as 87.57% at an initial ammonia nitrogen concentration of 500 mg / L. Furthermore, it possesses excellent ability to reduce ammonia release from animal feces. In ammonia removal tests conducted in pig farm environments, compared to the control group, the NH3 concentration decreased by 60.27% on day 6, significantly outperforming Bacillus subtilis and Bacillus licheniformis. This invention also provides the application of this Bacillus amyloliquefaciens.
Owner:HUNAN AGRI UNIV

Kitchen waste biological treatment emission reduction storage method and application thereof

The application discloses a kitchen garbage biological treatment emission reduction storage method and application thereof, and realizes rapid acidification of material storage process and reproduction of odor emission caused by moldy corruption by adding a composite lactic acid bacteria preparation. Meanwhile, before black soldier fly transformation of kitchen garbage, a Bayer conjugation yeast with acidophilic characteristics is added for secondary fermentation, organic acid (VFAs) and ammonia nitrogen in the material are converted into yeast cell protein, the inhibitory effect of free organic acid on the growth and reproduction of black soldier fly larvae is reduced, inorganic ammonia nitrogen is converted into biological organic nitrogen (amino acid, etc.), organic carbon in the material is converted into soluble nutrients (SCOD) which are more easily absorbed by black soldier fly, the transformation of kitchen garbage by black soldier fly larvae is promoted, and ammonia ion volatilization in the transformation process of black soldier fly is reduced. The related technology of the application is helpful for ammonia gas emission reduction and quality improvement and efficiency increase in the process of factory cultivation of black soldier fly.
Owner:JIANGSU ACAD OF AGRI SCI

Ammonia nitrogen removing agent for aquaculture and preparation method thereof

The application belongs to the field of aquaculture, and particularly relates to an ammonia-nitrogen removing agent for aquaculture and a preparation method thereof. The ammonia-nitrogen removing agent is composed of the following components in parts by weight: organic chlorine 8-10 parts, peroxide 6-8 parts, oxygen supplier 0.2-0.5 parts, catalyst 0.5-1 part, pH regulator 2 parts, and stabilizer 4-5 parts. The organic chlorine is sodium dichloroisocyanurate and cyanuric chloride, or cyanuric chloride. The catalyst is ferrocene. The pH regulator is sodium bisulfate and phosphate, or phosphate. The stabilizer is anhydrous sodium sulfate and anhydrous magnesium sulfate, or anhydrous sodium sulfate and anhydrous magnesium chloride. The application slowly releases hypochlorous acid through organic precursors, and degrades ammonia-nitrogen in water by combining with the ammonium magnesium phosphate method, so that the concentration is controllable and the effective period is long. While the ammonia-nitrogen removing agent of the application efficiently degrades ammonia-nitrogen, the problem of excessively high initial effective chlorine concentration is avoided, and the safety and stability of the treatment process are significantly improved.
Owner:NORTHEASTERN UNIV AT QINHUANGDAO +1

Application of black ink fruit extract in preparation of product for reducing methane emission and / or nitrogen emission of animals

The invention belongs to the technical field of agricultural waste resource utilization, and particularly relates to an application of a black ink fruit extract in preparation of a product for reducing methane emission and / or nitrogen excretion of animals, a preparation method of the black ink fruit extract comprises the following steps: drying black ink fruits, and crushing the dried black ink fruits to obtain black ink fruit powder; taking ethanol with a volume fraction of 60% as an extraction solvent, adding the black ink fruit powder for extraction, and collecting an extract liquid; and centrifuging, decolorizing, filtering, concentrating and freeze-drying the leaching solution to obtain the black ink fruit extract. According to the invention, it is proved for the first time that the black ink fruits can inhibit a methane generation key approach and reduce ammonia nitrogen concentration by regulating rumen fermentation while not damaging feed basic digestibility and animal health. The method not only directly brings emission reduction and environmental protection benefits, but also can improve the utilization efficiency of feed energy and protein, improve the milk protein rate and the feed conversion rate, and realize double improvement of environment and production benefits.
Owner:BEIJING UNIV OF AGRI +1

A culture method for increasing the content of lemna starch

PendingCN122319934ABiotechnologyPig farms
This invention discloses a cultivation method for increasing the starch content of duckweed, relating to the field of plant culture technology, comprising the following steps: taking pig farm biogas slurry, adjusting ammonia nitrogen to 10 mg / L~20 mg / L, total phosphorus to 0.1 mg / L~2.0 mg / L, and pH to 5.0~6.0, then inoculating initial duckweed into it and culturing for 5~7 days to obtain acclimatized duckweed; taking pig farm biogas slurry, adjusting ammonia nitrogen to 40~50 mg / L, total phosphorus to 0.4 mg / L~5.0 mg / L, and pH to 5.0~6.0, then adding sodium pyrophosphate and Bacillus amyloliquefaciens, then inoculating the acclimatized duckweed into it and culturing for 2~3 days to obtain high-starch duckweed. This invention constructs a two-step cultivation system of acclimatization and stress through culture solutions with differentiated nitrogen and phosphorus concentrations, and with the synergistic effect of sodium pyrophosphate and Bacillus amyloliquefaciens, achieves efficient and stable accumulation of duckweed starch.
Owner:LINGNAN MODERN AGRI SCI & TECH GUANGDONG PROVINCIAL LAB HEYUAN BRANCH CENT

Method for recovering phosphorus and co-producing slow-release fertilizer

The invention relates to the technical field of comprehensive utilization of salt lake lithium resources and wastewater treatment, and discloses a method for recovering phosphorus and co-producing a slow-release fertilizer. The method comprises the following steps: adjusting the pH value of the phosphorus-containing mother liquor to 9-10.5; mixing the phosphorus-containing mother liquor obtained in the previous step with a magnesium source and an ammonium source, controlling the molar ratio of Mg to N to P in the mixed system to be (1.1-2): (0.9-1.05): 1, and carrying out precipitation reaction under the condition that the pH value is 9-10.5 to obtain slurry containing magnesium ammonium phosphate crystals; carrying out solid-liquid separation on the slurry to obtain magnesium ammonium phosphate precipitate and mother liquor; washing and drying the magnesium ammonium phosphate precipitate to obtain a fertilizer-grade magnesium ammonium phosphate product; and directly returning the mother liquor to the salt pan. According to the method, through an innovative feeding scheme and process control, on the premise that subsequent deep denitrification is not needed, phosphorus and ammonia nitrogen in the effluent stably reach the standard at the same time, and a fertilizer product with economic value is produced.
Owner:MINMETALS SALT LAKE CO LTD

Denitrifying bacteria quantitative feeding method and system for aquaculture

The invention discloses a denitrifying bacteria quantitative putting method and system for aquaculture, and belongs to the technical field of aquaculture, and the technical scheme is characterized by comprising the following steps: obtaining the excretion amount and the bait residual amount of each type of fingerling in each fish pond within a fixed time; according to the excretion amount, the bait remaining amount and the long-short time sequence model, the ammonia nitrogen content in each fish pond within the preset time is predicted; according to the ammonia nitrogen content, a bacterium throwing pond and the bacterium throwing amount and the bacterium throwing type of the bacterium throwing pond are determined in all the fish ponds; according to the bacterium throwing amount and the bacterium throwing type, quantitative bacterium throwing of the bacterium throwing pool is completed. In the aquaculture process, ammonia nitrogen and nitrite can affect respiration, immunity and growth of fishes, denitrifying bacteria can reduce the concentration of the substances and maintain balance of a water body ecological system, and therefore the ammonia nitrogen content in all the fish ponds is predicted through the feeding amount, and the water body ecological system is predicted through the feeding amount. The bacterium feeding amount and bacterium feeding types are reasonably planned according to the types and growth stages of the fingerlings in the fishponds, and a suitable environment is provided for fingerling breeding.
Owner:GUANGDONG JINYINSHAN ENVIRONMENTAL PROTECTION TECH CO LTD

Ammonia direct oxidation denitrification device for water body remediation and composite microbial carrier

The invention discloses an ammonia direct oxidation denitrification device for water body remediation and a composite microbial carrier. The composite microbial carrier comprises an acetone slow-release inner core and a biological load shell, the acetone slow-release inner core is composed of an acetone-loaded solid adsorbent core and a calcium alginate gel wrapping layer, and precise and long-acting slow release of acetone is achieved through cooperation of adsorption immobilization and a gel diffusion barrier; the biological load shell is composed of polyurethane foam with a three-dimensional communicated macroporous structure, the inner core is wrapped in the shell, and the shell provides a three-dimensional space for microorganism attachment growth and AMAO reaction and delays outward diffusion of acetone. The device comprises a modular remediation unit assembled by a plurality of composite microbial carriers, the modular remediation unit is added into the ammonia nitrogen polluted water body, ammonia nitrogen in the water body is directly oxidized into nitrogen by the AMAO functional flora, and in-situ continuous denitrification is realized. The method solves the problems that the carbon source is easy to diffuse and lose and microorganisms are difficult to colonize, and has the advantages of high remediation efficiency, lasting effect and environmental friendliness.
Owner:CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACAD OF SCI +1

Organic matter collection device for aquaculture

ActiveCN309660115SFecesSuspended organic matter
1. The name of the design product: organic matter collecting device for aquaculture. 2. The use of the design product: for collecting residual feed feces and suspended organic matter, thereby reducing water turbidity and reducing ammonia accumulation. 3. The design points of the design product: in shape. 4. The picture or photo that best indicates the design points: perspective view.
Owner:QINGDAO SIBOREEN IND CO LTD

Method for evaluating ammonia nitrogen stress protection effect of fish feed raw material

The invention discloses a method for screening ammonia nitrogen stress protection effects of fish feed raw materials. The screening method comprises the following steps: S1, mixing a feed raw material to be evaluated with a basal feed, granulating, preparing a test feed, and feeding zebra fish; and S2, after fasting, transferring the zebrafish into an ammonium chloride solution for acute ammonia nitrogen stress, observing and recording death time until all the zebrafish die, and recording a survival curve of the zebrafish. According to the method provided by the invention, researchers and feed enterprises can objectively compare the relieving capacities of different raw materials on ammonia nitrogen stress. According to the invention, high efficiency and repeatability of the evaluation process are realized. The zebra fish model is low in cost and easy to operate, and experimental variable interference is reduced by combining a basal feed formula; according to the method, remarkable economic benefits and environmental benefits are brought, through index ranking, enterprises can preferentially select raw materials with high protection effects, the survival rate of fishes is increased, the culture cost is reduced, ammonia nitrogen stress can be dealt with, and the aquaculture industry is promoted to develop towards the green and intensive direction.
Owner:FEED RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Method and facility for anaerobic digestion of an effluent and degradation of ammonium

The invention relates to a method for anaerobic digestion of an effluent and reduction of its nitrogen load, the method comprising: - a step (102) of anaerobic digestion of the effluent in a digester (4), producing a digestate and ammonia nitrogen; - a step (106) of degrading ammonium ions originating from the digester in a bioreactor (24) for degrading ammonium ions, characterised in that the method comprises a step (104) of extracting the ammonia nitrogen formed during the anaerobic digestion step (102), during which a stream exiting the anaerobic digester is subjected to evaporation and condensation in order to produce an aqueous solution enriched in ammonium ions, and in that at least part of the aqueous solution enriched in ammonium ions is sent to the bioreactor (24) in order to supply at least some of the ammonium ions to be degraded.
Owner:SUEZ INTERNATIONAL

Method for high-efficiency degradation of high-salinity wastewater by salt-tolerant bacteria under a composite inorganic salt system

The application discloses a method for high-efficiency degradation of high-salinity wastewater by salt-tolerant bacteria in a composite inorganic salt system, and relates to the technical field of biological treatment of high-salinity industrial wastewater.The method realizes directional strengthening of the salt-tolerant performance of three strains of Staphylococcus xylosus, Alcaligenes faecalis and Bacillus cereus by a gradient-increasing NaCl domestication method.Under the condition of 40-50 g / L high salinity, the growth amount of the domesticated strains is increased by 30-40% compared with that of the non-domesticated strains, effectively relieving the osmotic pressure stress and metabolic enzyme activity inhibition of the microorganisms in the high-salinity environment.Meanwhile, the composite salt-tolerant bacteria agent is compounded based on functional complementation, and the agent has the abilities of efficient denitrification, phosphorus removal and organic matter degradation, and can adapt to the composite inorganic salt system of NaCl, CaCl2 and MgSO4 alone or in combination, and can realize synchronous and efficient removal of COD, ammonia nitrogen, total nitrogen and total phosphorus in a wide salinity range of 10-80 g / L.The method breaks through the technical limitation that the existing salt-tolerant bacteria only adapt to a single salt system and have single degradation function, and greatly widens the applicable scenarios of the biological method in the treatment of high-salinity wastewater.
Owner:XINJIANG INST OF ECOLOGY & GEOGRAPHY CHINESE ACAD OF SCI

Composition for improving aquaculture water quality and preparation method thereof

The invention belongs to the technical field of microbial products, and particularly relates to a composition for improving aquaculture water quality and a preparation method thereof. The composition comprises the following raw materials in parts by weight: 10-25 parts of compound bacterial powder, 8-15 parts of humic acid and 3-9 parts of bentonite. A preparation process of the compound bacterium powder comprises the following steps: inoculating a bacillus subtilis bacterium solution and a lactobacillus plantarum bacterium solution into a fermentation culture medium, and carrying out fermentation culture to obtain a fermentation product; and adding maggot powder and zein into the fermentation product, culturing, centrifuging, removing supernatant, and freeze-drying to obtain the compound bacterial powder. The composition for improving the aquaculture water quality can effectively reduce the concentration of ammonia nitrogen, total nitrogen, total phosphorus, nitrite and the like in a water body and improve the ecological environment of an aquaculture water area.
Owner:DIKANG SHIAN (BEIJING) AGRI TECH CO LTD

Denitrifying bacteria quantitative feeding method and system for aquaculture

The application discloses a nitrogen removal bacteria quantitative feeding method and system for aquaculture, and belongs to the technical field of aquaculture, and the technical scheme points of the application are as follows: the excretion amount of each type of fish in each fish pond and the bait residual amount in a fixed time are obtained; the ammonia nitrogen content in each fish pond in a preset time is predicted according to the excretion amount, the bait residual amount and a long-short time sequence model; the bacteria feeding pond, the bacteria feeding amount and the bacteria feeding type of the bacteria feeding pond in each fish pond are determined according to the ammonia nitrogen content; and the quantitative bacteria feeding of the bacteria feeding pond is completed according to the bacteria feeding amount and the bacteria feeding type. In the aquaculture process, ammonia nitrogen and nitrite can affect the respiration, immunity and growth of fish, and the nitrogen removal bacteria can reduce the concentration of these substances and maintain the balance of the water ecosystem, so that the ammonia nitrogen content in each fish pond is predicted through bait feeding amount, and the bacteria feeding amount and the bacteria feeding type are reasonably planned in combination with the fish type and the growth stage in each fish pond, so that a suitable environment is provided for fish breeding.
Owner:GUANGDONG JINYINSHAN ENVIRONMENTAL PROTECTION TECH CO LTD

Purification treatment process for livestock breeding sewage

The invention discloses a purification treatment process for livestock breeding sewage, and belongs to the technical field of functional microbial materials and application. According to the invention, by introducing the composite functional microbial agent and the mushroom bran-based biomass composite filler, efficient removal of ammonia nitrogen, COD and other pollutants in sewage is realized, and the risk of secondary pollution caused by a traditional chemical treatment method is greatly reduced. Pseudomonas filbertii, microbacterium keratinolyticum and bacillus licheniformis in the composite functional microbial agent have a synergistic effect, so that organic matters and ammonia nitrogen in sewage can be rapidly degraded, and the composite functional microbial agent also has a good flocculation effect, has good environmental adaptability and stability, and can cope with complex and variable water quality conditions. In addition, the mushroom bran-based biomass composite filler is subjected to acid pickling activation and iron-chitosan loading modification, so that the adsorption performance and nitrogen and phosphorus removal capacity of the mushroom bran-based biomass composite filler are remarkably improved, and the deep treatment effect is further optimized. The process is simple and convenient to operate, low in operation cost and suitable for sewage treatment requirements of large-scale farms.
Owner:临沂市畜牧发展促进中心

Device and method for realizing short-cut nitrification and short-cut denitrification coupled anaerobic ammonia oxidation low-carbon-nitrogen-ratio sewage denitrification based on two-stage membrane aeration bio-membrane reactor

The invention discloses a device and a method for realizing short-cut nitrification and short-cut denitrification coupled anaerobic ammonia oxidation low-carbon-nitrogen-ratio sewage denitrification based on a two-stage membrane aeration bio-membrane reactor. According to the device, a hollow fiber membrane is adopted as an oxygen transfer medium, and oxygen is diffused through the membrane to form an oxygen concentration gradient through a bubble-free membrane aeration technology, so that the surface of the membrane is divided into an oxygen-enriched region and an oxygen-poor region. In the anoxic zone, the system performs short-cut denitrification coupled anaerobic ammonia oxidation (PD / A) reaction, and performs synchronous nitrification and denitrification in the biological membrane zone at the same time, so that partial reduction of ammonia nitrogen and removal of COD (Chemical Oxygen Demand) are realized; and in the aerobic section, functional partitions of nitrifying bacteria and anaerobic ammonium oxidation bacteria are established by controlling the dissolved oxygen concentration gradient on the biological membrane, so that short-cut nitrification coupled anaerobic ammonium oxidation denitrification is realized. According to the two-stage MABR denitrification system, the energy loss is reduced, the denitrification contribution rate of anaerobic ammonia oxidation is enhanced, an efficient solution is provided for deep denitrification of sewage with a low carbon-nitrogen ratio, and the two-stage MABR denitrification system has an application prospect.
Owner:BEIJING UNIV OF TECH

High-urine-content excrement ammonia nitrogen recovery and fertilization method based on high-temperature coupling gaseous membrane

A high-urine-content excrement ammonia nitrogen recycling and fertilizing method based on a high-temperature coupling gaseous membrane is characterized by comprising the steps that high-urine-content livestock and poultry excrement with the ammonia nitrogen concentration larger than 1500 mg / L is placed in a high-temperature constant-temperature reactor, the temperature is increased, the activity of urease is improved, the hydrolysis rate of protein is increased, and the ammonia nitrogen concentration in the reactor is increased; the livestock and poultry manure heated in the high-temperature constant-temperature reactor is sent to an efficient solid-liquid separation system, a liquid phase and a solid phase are separated out, and the solid phase is directly used as an organic fertilizer; adding an alkaline substance into the liquid phase, and adjusting the pH value for ammoniation; separating ammonia by using a gaseous membrane, and absorbing by using a sulfuric acid solution to form an ammonium sulfate solution; and crystallizing the ammonium sulfate solution by adopting an evaporator to obtain ammonium sulfate crystals. According to the invention, through the synergistic effect of high-temperature ammonolysis promotion, high-efficiency solid-liquid separation and gaseous membrane deamination, ammonia nitrogen recovery of high-urine-content excrement is realized, and a solid organic fertilizer and an ammonium sulfate fertilizer are produced.
Owner:TIANJIN MUNICIPAL ENGINEERING DESIGN & RESEARCH INSTITUTE CO LTD