91 results about "Ammonia n" patented technology

The invention belongs to the technical field of agricultural microorganisms, and particularly relates to a coxakella cocori strain as well as a microbial agent and an application of the coxakella cocori strain. The invention discloses a strain of coxakella coraldii T6-2, which is preserved in the China General Microbiological Culture Collection Center on July 10, 2024, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.31262. The invention further discloses a preparation method of the coxakella coraldii T6-2. The strain has the characteristics of salt resistance, alkali resistance and high ammonium resistance; the strain has biological activities of dissolving phosphorus, fixing nitrogen and secreting IAA, and has an obvious promotion effect on soybean growth under salt stress; the strain has extremely strong ammonia nitrogen degradation activity, the initial concentration of ammonia nitrogen is in a range of 50-100 mg / L, and after treatment is performed for 36 h, the ammonia nitrogen degradation rate reaches 90% or above. The strain has extremely high application value in plant growth promotion and ammonia nitrogen waste biodegradation in saline-alkali and high-ammonium environments.

The invention provides an inoculum domestication method for relieving acid or ammonia nitrogen inhibition of an anaerobic fermentation system, which comprises the following steps of: carrying out constant-temperature anaerobic fermentation culture at medium temperature (30-35 DEG C) or high temperature (50-55 DEG C) until the gas yield is stable by taking livestock manure, activated sludge, industrial anaerobic digestion residues or mineralized refuse biogas fermentation liquor and the like as inoculums; the obtained inoculum is an inoculum which has relatively strong acid tolerance or ammonia nitrogen tolerance after domestication. The domesticated inoculum with good tolerance and the original untreated inoculum are mixed according to a certain proportion and then put into an anaerobic fermentation system, and wet fermentation (TS = 5-10% and total solid content) or dry fermentation (TS = 20-30%) is carried out, so that the pH value of the anaerobic fermentation system is recovered to a state suitable for growth of methanogens.

The invention belongs to the technical field of environmental protection of bioremediation wastewater, and discloses an immobilized adsorption microsphere, which is prepared from Bacillus spp., Candida utilis and European nitrosomonas through an immobilized embedding technology. The microspheres provided by the invention can effectively repair glutamic acid high ammonia nitrogen fermentation wastewater.

The application discloses a method for efficient denitrification and decarburization of kitchen waste and sludge co-fermentation anaerobic digestion effluent, which removes part of COD and ammonia nitrogen in the influent sludge by using a first SNAD, and maintains a certain amount of free ammonia of a certain concentration due to the high concentration of ammonia nitrogen and the high pH of the influent, so as to maintain the inhibition effect on nitrifying bacteria and ensure the conversion of part of the ammonia nitrogen into nitrite nitrogen, and the high activity of anaerobic ammonia oxidation bacteria is ensured in the first SNAD by limiting the aeration amount, so that the ammonia nitrogen and nitrite can be further removed; the effluent enters a nitrification tank, and the ammonia nitrogen is nitrified into nitrate nitrogen under the condition of nitrifying bacteria and sufficient aeration amount, and then enters a denitrification tank, and the denitrification process is carried out under the condition of heterotrophic denitrifying bacteria and sufficient carbon source, so that most of the nitrate nitrogen in the system is converted into nitrogen gas and removed, finally, the clear liquid is discharged after being filtered by an MBR membrane in a membrane tank, so as to achieve the purpose of efficient denitrification and decarburization of kitchen waste anaerobic digestion effluent.

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.

The invention discloses a heterotrophic-aerobic denitrifying bacterium C-3 and application thereof, the heterotrophic-aerobic denitrifying bacterium C-3 is preserved in the China General Microbiological Culture Collection Center (CGMCC), is classified and named as brevundimonas, has the preservation number of CGMCC No.31729, and is preserved on August 23, 2024. The heterotrophic-aerobic denitrifying bacterium C-3 has the advantages that the preservation number is CGMCC No.31729, and the preservation date is 2024. The heterotrophic-aerobic denitrifying brevundimonas vesicularis C-3 (Brevundimonas vesicularis C-3) provided by the invention takes sodium acetate as a carbon source, and under the aerobic conditions that the C / N mass ratio is 10, the pH value is 7, the temperature is 30 DEG C and the rotating speed is 200r / min, a relatively good nitrate nitrogen removal effect is achieved, and the removal effect is 100%; in actual aquaculture tail water, nitrate nitrogen, nitrite nitrogen, ammonia nitrogen and total nitrogen can be well removed; meanwhile, the strain has high safety and has good application value in treatment of aquaculture tail water.

The invention discloses an MOFs composite membrane for ammonia separation and a preparation method thereof, and the preparation method comprises the following steps: S1, mixing a metal compound, an organic ligand and a solvent according to a specific molar ratio, reacting at a specific temperature to form an MOF material, and activating the MOF material as a seed crystal; s2, preparing the MOF material into a solution with a specific concentration, uniformly mixing the MOF material with the solution through a stirring, ultrasonic treatment and impregnation method or a method combining stirring, ultrasonic treatment and impregnation, and then introducing the solution to one main surface of a porous support layer to obtain a support layer membrane; and S3, preparing a metal organic framework material synthetic solution with the same molar ratio as that in the step S1, then putting the support layer membrane with seed crystal introduced on the surface into the metal organic framework material synthetic solution, and performing vacuum heating, drying and activating under the same reaction condition as that in the step S1 to form the MOFs composite membrane. The obtained composite membrane has an efficient ammonia separation effect, and when the composite membrane is used for separating ammonia-containing gas, the ammonia permeability reaches up to 2956.9 GPU, and the ammonia / nitrogen selectivity and the ammonia / hydrogen selectivity respectively reach up to 620.1 and 180.8.

The invention relates to the technical field of environmental microbial resource development and sewage denitrification. The invention discloses an efficient denitrification strain Paracoccus sp.N21 with a flocculation characteristic, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.34710. The invention further discloses a preparation method of the efficient denitrification strain Paracoccus sp.N21. The strain obtained by the invention can completely remove ammonia nitrogen within 12 hours and thoroughly remove nitrate nitrogen within 48 hours, the removal rate reaches 100%, and ammonia nitrogen is preferentially degraded in a mixed nitrogen source. The method has the unique advantages that the flocculation rate in the nitrification process and the flocculation rate in the denitrification process exceed 93.9%, and the usage amount of a flocculating agent can be greatly reduced. When actual kitchen wastewater is treated, the ammonia nitrogen removal rate reaches 100%, and the removal rate reaches up to 7.51 mg / (L.h). The application of the strain can effectively reduce the volume of a reactor, reduce energy consumption and operation cost, provides a new solution for simplifying a biological denitrification process, is particularly suitable for treating high-ammonia-nitrogen kitchen wastewater, and has remarkable environmental and economic benefits.

The invention discloses an ammonia nitrogen adsorption material for soil improvement as well as a preparation method and application thereof. The preparation method comprises the following steps: firstly, mixing straw chippings with zeolite powder to obtain a mixed raw material; then putting the mixed raw material into a high-temperature tubular furnace for co-pyrolysis to obtain a composite co-pyrolysis product; and finally, adding the composite co-pyrolysis product into a NaOH solution, uniformly stirring, oscillating and dipping, taking out, repeatedly cleaning with deionized water to be neutral, and drying in a drying oven to prepare an alkali modified product, namely the ammonia nitrogen adsorption material. According to the application, the material adsorbing NH4 < + >-N is added into soil and is used for improving soil performance, so that germination and growth of plants are promoted; the composite material with high NH4 < + >-N adsorption capacity is prepared through co-pyrolysis of the zeolite and the straw, the composite material adsorbing NH4 < + >-N serves as a soil conditioner to be recycled, the adsorption performance of the biochar material to NH4 < + >-N is improved by supplementing the zeolite, and meanwhile the natural loose and porous mineral property of the biochar material also has the feasibility of soil improvement.

The invention discloses a compound microbial agent and an application thereof, and the compound microbial agent is characterized in that the compound microbial agent is prepared by compounding Escherichia coli SQ-1A, Acinetobacter radiobacter radioreae SQ-1B and Klebsiella michelianensis WF-2 according to a volume ratio of 1: 1: 1, and the compound microbial agent is prepared by compounding the following raw materials in parts by volume: 1: 1, 1: 1, 1: 1, 1: 1: 1, 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1: 1. The invention aims to prepare the compound microbial agent with high ammonia nitrogen degradation rate.

The invention discloses a kitchen waste biological treatment and emission reduction storage method and application thereof. By adding a compound lactic acid bacteria preparation, odor emission caused by rapid acidification and reproduction mildewing and corruption in the material storage process is achieved. Meanwhile, before the hermetia illucens is converted into the kitchen waste, zygosaccharomyces bayer with the acidophilic characteristic is added for secondary fermentation, organic acid (VFAs) and ammonia nitrogen in the material are converted into yeast protein, the inhibition effect of free organic acid on growth and reproduction of hermetia illucens larvae is reduced, inorganic ammonia nitrogen is converted into biological organic nitrogen (amino acid and the like), and the biological organic nitrogen is converted into biological organic nitrogen (amino acid and the like); organic carbon of the material is converted into soluble nutrients (SCOD) which are more easily absorbed by the hermetia illucens, so that the larvae of the hermetia illucens are promoted to quickly and efficiently convert the kitchen waste, and the volatilization of ammonia ions in the conversion process of the hermetia illucens is reduced. The related technology provided by the invention is beneficial to ammonia emission reduction and quality and efficiency improvement in the process of industrial breeding of hermetia illucens.

The invention discloses a production method of low-salt high-ammonia-nitrogen cost-reducing soy sauce, and relates to the technical field of seasonings. The production method comprises the following steps: mixing salt water into finished koji after a koji making stage, discharging the koji, preparing mash, adding cured and crushed soybeans in the process, and carrying out heat preservation and fermentation. According to the method, residual enzyme active resources in the existing starter propagation process are utilized, and a proper amount of cured soybeans are added in the fermentation process for secondary utilization. Substrate adaptation and technological parameters are cooperatively regulated and controlled, so that surplus enzyme activity is fully utilized, meanwhile, the inner surface area of the cured soybeans is increased, decomposition and utilization of enzymes and microorganisms are facilitated, and the enzyme-substrate contact efficiency is remarkably improved. The fermentation temperature, the fermentation duration and the concentration of saline water are optimized, the utilization rate of enzyme activity is maximized, macromolecules such as protein are converted more efficiently, the fermentation cost is remarkably reduced, and the fermentation period is shortened. The salt content of the produced soy sauce is 8.92 g / 100 mL, the amino acid nitrogen content is 1.374 g / 100 mL, the total nitrogen content is 2.223 g / 100 mL, and a solution is provided for production of the low-salt high-freshness soy sauce.

The application provides a method for producing biogas by anaerobic fermentation of pea protein wastewater, and relates to the technical field of biomass energy utilization, wherein the chemical oxygen demand is 10000-15000 mg / L, the ammonia nitrogen is 400-800 mg / L, and the sulfate radical is 600-1000 mg / L; the method comprises the following steps: (1) gradient micro-oxygen hydrolysis acidification pretreatment; (2) physical-chemical and biochemical synergistic intensified pretreatment; and (3) anaerobic methane production. The method for producing biogas by anaerobic fermentation of pea protein wastewater is capable of effectively inhibiting sulfate reducing bacteria, reducing hydrogen sulfide generation, reducing free ammonia toxicity and accelerating hydrolysis of macromolecular organic matter through gradient micro-oxygen hydrolysis acidification. In combination with modified tourmaline ceramic and magnetization synergistic treatment, the microbial activity and mass transfer efficiency are further improved. The whole process can be stably operated, the COD removal rate, the biogas yield and the methane content are significantly improved, and the harmless treatment of the pea protein wastewater and the resource utilization of the biogas are efficiently realized.

The application discloses a method for continuously fermenting urine to produce safe fertilizer, which comprises the following steps: in the first fermentation, adding environment-friendly enzyme into a container, then collecting fresh urine and adding molasses, and carrying out fermentation in a sealed manner; after the fermentation is completed, reserving part of the fermentation liquor as a substrate; and in the subsequent batches, directly adding fresh urine and molasses into the container with the substrate to carry out fermentation, so as to realize continuous circulation. The method can inhibit the hydrolysis process of urea in the urine in the early stage by timely adding environment-friendly enzyme (or the fermentation liquor of the last time) and molasses into the fresh urine to carry out fermentation, thereby greatly reducing the ammonia nitrogen volatilization amount, and the pathogenic bacteria in the urine can be inhibited to a very low level in a short period of time. Except that the environment-friendly enzyme needs to be added in the first fermentation, the environment-friendly enzyme does not need to be added in the subsequent batches of fermentation, and only a small amount of molasses needs to be added. A large amount of beneficial bacteria such as lactic acid bacteria and yeast and metabolic products such as lactic acid and acetic acid are generated in the fermentation process, so that the urine is converted into microbial bacterial fertilizer.

The invention belongs to the field of animal feeding, and particularly relates to application of bacillus megatherium in preparation of fermented feed for reducing methane emission of mutton sheep, the bacillus megatherium is preserved in the China General Microbiological Culture Collection Center on December 6, 2004, and the preservation number is GMCCNo.1259. The invention also provides a fermented feed for reducing methane emission of mutton sheep, the degradation rate of straw rumen dry matter and crude protein can be remarkably increased, the ammonia nitrogen content in the feed is remarkably reduced, and the lactic acid bacteria content is remarkably increased.

The invention discloses a nitrogen source feeding control method in a tylosin fermentation process, and belongs to the technical field of tylosin fermentation. A nitrogen source material supplementing control method in the tylosin fermentation process comprises two stages of dynamic material supplementing and comprises the following specific steps that in the early stage of fermentation, after a fermentation tank runs for 20 hours, continuous culture is conducted, the titer of tylosin in fermentation liquor is detected regularly, an ammonium nitrate solution starts to be supplemented, and the pH value of the fermentation liquor is stabilized between 6.55 and 6.80 through material supplementing. According to the nitrogen source feeding control method in the tylosin fermentation process, key parameters such as pH, dissolved oxygen, biomass and ammonia nitrogen concentration are collected in real time through cooperative work of the PLC system and the online sensor, the ammonium nitrate feeding rate is dynamically adjusted, nitrogen source supply is highly matched with thallus metabolism requirements, nitrogen source waste or insufficiency is avoided, and the production efficiency is improved. The nitrogen source utilization efficiency is improved; and a carbon source synchronous supplementing strategy is combined to stabilize a fermentation liquid environment, promote rapid growth of thalli and prolong a stable growth period.

The present application relates to the technical field of feeding and dosing device, especially relates to an automatic feeding and dosing device for anti-blocking granular ammonia-nitrogen removing agent and a feeding method thereof. The automatic feeding and dosing device and the feeding method thereof are aimed at solving the technical problems that the labor intensity of workers is large, dust is harmful to human body, the continuity and uniformity of dosing cannot be guaranteed, and the saving of reagent is not conducive in the prior art. The present application provides an automatic feeding and dosing device for anti-blocking granular ammonia-nitrogen removing agent, which comprises a supporting column, a material bin, a lifting control device, a guide assembly, an outer dust cover, a rotary control assembly, a sealing cover plate, a limiting seat, a screen, a flexible knocking assembly, a power device, a spraying pipe, a nozzle and a discharging adjusting assembly. The present application adopts a crane to automatically feed the ammonia-nitrogen removing agent, ensures the continuity and uniformity of dosing of the ammonia-nitrogen removing agent, saves the amount of the ammonia-nitrogen removing agent, effectively suppresses dust dispersion through spraying, and reduces the harm to human body.

The invention relates to a method for reducing nitrogen loss in a biogas slurry returning and utilization process. The method comprises the following steps: providing biochar; mixing the biochar with kitchen biogas slurry, and mixing and stirring under a constant temperature condition to obtain a biochar biogas slurry mixture; the charcoal and biogas slurry mixture is mixed with soil, so that the nitrogen loss can be reduced. According to the method, kitchen biogas slurry generated by anaerobic fermentation of kitchen waste and biochar are mixed and returned to the field, so that the use cost of wood vinegar is reduced, and the influence of biogas slurry coupled straw returning to the field on crops is avoided. The biochar can fix nitrogen nutrients in the biogas slurry through adsorption, slow release and immobilization effects of the biochar; nitrification can be inhibited, conversion of ammonia nitrogen to nitrate nitrogen is delayed, nitrate is promoted to be reduced into ammonia, and nitrate nitrogen is converted into ammonia nitrogen to be reserved; in addition, the biochar provides a habitat for nitrogen circulating microorganisms, nitrogen turnover of the farmland is accelerated, and therefore nitrogen loss caused by returning of the biogas slurry to the field is reduced.

The invention relates to a method for extracting molybdenum through complexation and reverse extraction, belongs to the field of non-ferrous metal hydrometallurgy, and solves the problems that ammonia nitrogen and sodium salt wastewater can be generated when molybdenum is extracted from an acid leaching solution through an extraction method in the prior art, and the environment is seriously polluted; the organic phase needs pickling regeneration, a large amount of acidic reagents are consumed, and the molybdenum extraction cost is increased; and the reverse extraction rate is low. The method comprises the following steps: extracting an acid leaching solution of molybdenum by using a cationic extractant at normal temperature, and separating after extraction to obtain a molybdenum-containing loaded organic phase and an acid raffinate; the molybdenum-containing loaded organic phase is subjected to back extraction with a back extraction agent containing oxalic acid, and an organic phase and molybdenum-enriched back extraction liquid are obtained through separation; and the reverse-extracted organic phase is used as an extracting agent to circularly extract molybdenum in the acid leaching solution. According to the method, the molybdenum-containing acidic leachate is extracted by using the cationic extractant at normal temperature, and the molybdenum-containing loaded organic phase is subjected to reverse extraction by using oxalic acid (or oxalic acid and hydrogen peroxide), so that the environment is optimized, and the reverse extraction rate of molybdenum is improved.

This invention discloses a fibrous microbacterium and its applications. The fibrous microbacterium, named IURM R23 and taxonomically named *Cellulosimicrobium cellulans*, was deposited on January 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 29729. The fibrous microbacterium provided by this invention exhibits highly efficient ammonia nitrogen degradation performance under high-salt conditions. The optimal degradation temperature for ammonia nitrogen by this fibrous microbacterium is 30–35°C, and the degradation effect is best under neutral pH conditions. The fibrous microbacterium provided by this invention tolerates low C / N ratios and has a wide tolerance range, thus possessing highly efficient nitrogen removal capabilities.

The application discloses a high-ammonia-nitrogen wastewater simultaneous nitrification and denitrification and chromium remediation method based on a microorganism-promoter combination. 12 The combination is composed of simultaneous nitrification and denitrification bacteria and sodium azide (NaN3), alanine and dodecamolybdenum phosphate (PMo 12 ) and is used for detoxifying dissolved heavy metal chromium and improving denitrification efficiency. The method is to culture SND simultaneous short-cut nitrification and denitrification biological bacteria under aerobic conditions, inoculate the biological bacteria into a high-chromium solution, add biological promoters, promote the growth of microorganisms and the conversion of nitrogen, continuously receive and provide electrons in a reversible oxidation-reduction process, thereby reducing the total activation energy of the reaction and efficiently detoxifying heavy metal chromium. The microorganism-promoter combination technology obtained in this way can not only realize efficient simultaneous nitrification and denitrification in high-ammonia-nitrogen wastewater, but also maintain the biological activity of the SND bacteria in a high-chromium environment, thereby providing reliable technical support for efficient chromium removal and toxicity remediation of high-ammonia-nitrogen wastewater.

This invention belongs to the field of biotechnology and discloses a strain of Bacillus amyloliquefaciens ZJ02 that inhibits bacterial growth and reduces ammonia nitrogen. Its accession number is CCTCC NO: M20252399, the accession date is October 30, 2025, and the depositary institution is the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China. ZJ02 exhibits significant antibacterial effects against Escherichia coli and Salmonella, with an inhibition zone size of 18.11 mm against Salmonella (SA) after 24 hours. Compared to other strains, it demonstrates superior ammonia nitrogen degradation under the same conditions, achieving a degradation rate of 76.58%, reaching as high as 87.57% at an initial ammonia nitrogen concentration of 500 mg / L. Furthermore, it possesses excellent ability to reduce ammonia release from animal feces. In ammonia removal tests conducted in pig farm environments, compared to the control group, the NH3 concentration decreased by 60.27% on day 6, significantly outperforming Bacillus subtilis and Bacillus licheniformis. This invention also provides the application of this Bacillus amyloliquefaciens.

The present invention relates to the field of anaerobic digestion, and specifically to a method for preparing magnetic biochar for immobilizing ammonia nitrogen-tolerant anaerobic microorganisms and a method for alleviating ammonia nitrogen inhibition. The present invention first domesticates anaerobic microorganisms with high tolerance to ammonia nitrogen under ammonia stress conditions, and the microbial structure and function are more complete, the adaptability is strong, and the microorganisms have general tolerance to high ammonia nitrogen systems. Then, the microorganisms with high tolerance to ammonia nitrogen are immobilized on magnetic biochar materials to construct a microhabitat system rich in ammonia nitrogen-tolerant anaerobic microorganisms, thereby ensuring efficient anaerobic digestion under high ammonia nitrogen conditions.

The application discloses a kitchen garbage biological treatment emission reduction storage method and application thereof, and realizes rapid acidification of material storage process and reproduction of odor emission caused by moldy corruption by adding a composite lactic acid bacteria preparation. Meanwhile, before black soldier fly transformation of kitchen garbage, a Bayer conjugation yeast with acidophilic characteristics is added for secondary fermentation, organic acid (VFAs) and ammonia nitrogen in the material are converted into yeast cell protein, the inhibitory effect of free organic acid on the growth and reproduction of black soldier fly larvae is reduced, inorganic ammonia nitrogen is converted into biological organic nitrogen (amino acid, etc.), organic carbon in the material is converted into soluble nutrients (SCOD) which are more easily absorbed by black soldier fly, the transformation of kitchen garbage by black soldier fly larvae is promoted, and ammonia ion volatilization in the transformation process of black soldier fly is reduced. The related technology of the application is helpful for ammonia gas emission reduction and quality improvement and efficiency increase in the process of factory cultivation of black soldier fly.

The application belongs to the field of aquaculture, and particularly relates to an ammonia-nitrogen removing agent for aquaculture and a preparation method thereof. The ammonia-nitrogen removing agent is composed of the following components in parts by weight: organic chlorine 8-10 parts, peroxide 6-8 parts, oxygen supplier 0.2-0.5 parts, catalyst 0.5-1 part, pH regulator 2 parts, and stabilizer 4-5 parts. The organic chlorine is sodium dichloroisocyanurate and cyanuric chloride, or cyanuric chloride. The catalyst is ferrocene. The pH regulator is sodium bisulfate and phosphate, or phosphate. The stabilizer is anhydrous sodium sulfate and anhydrous magnesium sulfate, or anhydrous sodium sulfate and anhydrous magnesium chloride. The application slowly releases hypochlorous acid through organic precursors, and degrades ammonia-nitrogen in water by combining with the ammonium magnesium phosphate method, so that the concentration is controllable and the effective period is long. While the ammonia-nitrogen removing agent of the application efficiently degrades ammonia-nitrogen, the problem of excessively high initial effective chlorine concentration is avoided, and the safety and stability of the treatment process are significantly improved.

The invention belongs to the technical field of agricultural waste resource utilization, and particularly relates to an application of a black ink fruit extract in preparation of a product for reducing methane emission and / or nitrogen excretion of animals, a preparation method of the black ink fruit extract comprises the following steps: drying black ink fruits, and crushing the dried black ink fruits to obtain black ink fruit powder; taking ethanol with a volume fraction of 60% as an extraction solvent, adding the black ink fruit powder for extraction, and collecting an extract liquid; and centrifuging, decolorizing, filtering, concentrating and freeze-drying the leaching solution to obtain the black ink fruit extract. According to the invention, it is proved for the first time that the black ink fruits can inhibit a methane generation key approach and reduce ammonia nitrogen concentration by regulating rumen fermentation while not damaging feed basic digestibility and animal health. The method not only directly brings emission reduction and environmental protection benefits, but also can improve the utilization efficiency of feed energy and protein, improve the milk protein rate and the feed conversion rate, and realize double improvement of environment and production benefits.

The present invention provides a Pseudomonas aeruginosa HRKJ-4, a microbial preparation and an application thereof. The deposit number of Pseudomonas aeruginosa HRKJ-4 is CGMCC No. 24351, and the strain has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on January 20, 2022. The strain can grow well and remove ammonia nitrogen in the salinity range of 5-40g / L, especially when the salinity is 40g / L, it can also show a promoting effect on bacterial growth, and has good application prospects in the denitrification treatment of high-ammonia nitrogen livestock and poultry breeding wastewater with medium and high salinity.

This invention discloses a cultivation method for increasing the starch content of duckweed, relating to the field of plant culture technology, comprising the following steps: taking pig farm biogas slurry, adjusting ammonia nitrogen to 10 mg / L~20 mg / L, total phosphorus to 0.1 mg / L~2.0 mg / L, and pH to 5.0~6.0, then inoculating initial duckweed into it and culturing for 5~7 days to obtain acclimatized duckweed; taking pig farm biogas slurry, adjusting ammonia nitrogen to 40~50 mg / L, total phosphorus to 0.4 mg / L~5.0 mg / L, and pH to 5.0~6.0, then adding sodium pyrophosphate and Bacillus amyloliquefaciens, then inoculating the acclimatized duckweed into it and culturing for 2~3 days to obtain high-starch duckweed. This invention constructs a two-step cultivation system of acclimatization and stress through culture solutions with differentiated nitrogen and phosphorus concentrations, and with the synergistic effect of sodium pyrophosphate and Bacillus amyloliquefaciens, achieves efficient and stable accumulation of duckweed starch.

The invention relates to the technical field of comprehensive utilization of salt lake lithium resources and wastewater treatment, and discloses a method for recovering phosphorus and co-producing a slow-release fertilizer. The method comprises the following steps: adjusting the pH value of the phosphorus-containing mother liquor to 9-10.5; mixing the phosphorus-containing mother liquor obtained in the previous step with a magnesium source and an ammonium source, controlling the molar ratio of Mg to N to P in the mixed system to be (1.1-2): (0.9-1.05): 1, and carrying out precipitation reaction under the condition that the pH value is 9-10.5 to obtain slurry containing magnesium ammonium phosphate crystals; carrying out solid-liquid separation on the slurry to obtain magnesium ammonium phosphate precipitate and mother liquor; washing and drying the magnesium ammonium phosphate precipitate to obtain a fertilizer-grade magnesium ammonium phosphate product; and directly returning the mother liquor to the salt pan. According to the method, through an innovative feeding scheme and process control, on the premise that subsequent deep denitrification is not needed, phosphorus and ammonia nitrogen in the effluent stably reach the standard at the same time, and a fertilizer product with economic value is produced.

The invention discloses a denitrifying bacteria quantitative putting method and system for aquaculture, and belongs to the technical field of aquaculture, and the technical scheme is characterized by comprising the following steps: obtaining the excretion amount and the bait residual amount of each type of fingerling in each fish pond within a fixed time; according to the excretion amount, the bait remaining amount and the long-short time sequence model, the ammonia nitrogen content in each fish pond within the preset time is predicted; according to the ammonia nitrogen content, a bacterium throwing pond and the bacterium throwing amount and the bacterium throwing type of the bacterium throwing pond are determined in all the fish ponds; according to the bacterium throwing amount and the bacterium throwing type, quantitative bacterium throwing of the bacterium throwing pool is completed. In the aquaculture process, ammonia nitrogen and nitrite can affect respiration, immunity and growth of fishes, denitrifying bacteria can reduce the concentration of the substances and maintain balance of a water body ecological system, and therefore the ammonia nitrogen content in all the fish ponds is predicted through the feeding amount, and the water body ecological system is predicted through the feeding amount. The bacterium feeding amount and bacterium feeding types are reasonably planned according to the types and growth stages of the fingerlings in the fishponds, and a suitable environment is provided for fingerling breeding.